Alliopsis silvestris

(Fallén, 1824) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Anthomyiidae/Alliopsis

At a glance

Occurrence records638

Data sources6

Biological traits0

DNA specimens115

eDNA detections941

Sources6 archives

Databases and archives Alliopsis silvestris's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility638 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI941 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics115 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF638 records

Environmental DNA5 datasets · 7 countries941 detections

DNA & barcodingBOLD115 specimens

01Narrative

Alliopsis silvestris is een vliegensoort uit de familie van de bloemvliegen (Anthomyiidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1824 door Fallen.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding115 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alliopsis silvestris has left across the world's sequence archives.

At a glance

DNA specimens115

BINs1

Marker genes2

eDNA detections941

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus98 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

103Cvariable

340Cvariable

ATTATATTTTATTTTTGGAGCATGATCAGGAATAGTAGGAACTTCCTTAAGTATTTTAATTCGAACTGAATTAGGCCACCCTGGAGCATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.19%

Haplotypes15

BIN1

Most divergent pair0.61%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alliopsis billbergisame genus4.8%Alliopsis denticaudasame genus5.4%Alliopsis fractisetasame genus5.4%Alliopsis teriolensissame genus5.4%Alliopsis constrictorsame genus5.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P

animal barcoderibosomal

08Occurrence & distribution

Record type638 records

Wild obs. + sensor329

Museum / vouchered309

Range

Area of Occupancy AOO1 396 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 151≤1 km 106≤10 km 69>10 km 3

329 georeferenced

Open the mapobservation + sensor329

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 88≤1 km 34≤10 km 55>10 km 42

219 georeferenced · 90 without coordinates

Open the institutions mapphysical evidence309

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	63
Tromsø, NO	29
University of Guelph, Centre for Biodiversity Genomicslocation not on record	27
University of Tokyo, Department of Zoologylocation not on record	25
Metsähallituslocation not on record	25
Edmonton, CA	17
Stockholm, SE	12
SLU Artdatabankenlocation not on record	8
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	7
DOI/FWS, Kenai National Wildlife Refugelocation not on record	5
NHMOlocation not on record	4
Rovaniemi, FI	3
MZLUlocation not on record	3
ZMAAlocation not on record	1

14 institutions · 229 of 309 vouchered records shown · 80 without an institution code

09Environmental DNA941 detections

Where the DNA of Alliopsis silvestris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found941

Studies independent surveys5

Countries7

Verifiable raw sequence linked769

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 941 detections have coordinates

Open the map7 countries0

1. Forest & Woodland1. Forest & Woodland|1.1. Boreal ForestOlder mixed coniferous forestBoreal forest1. Forest & Woodland | 1.1 Boreal Forest3. Shrubland | 3.1. Subarctic Shrubland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 9.90–16.2

Seasonal swing summer↔winter24.0 °C

Max temp (day)17.0 °C 11.7–19.5

Min temp (night)8.80 °C 5.70–11.6

Precipitation98.9 mm/mo 66.0–144

Air humidity59.0 % 55.6–64.2

Moisture balance-8.70 mm/mo -46.9–54.4

Vapour deficit649 Pa 432–754

Wind speed2.70 m/s 1.80–4.20

Cloud cover52.1 % 43.2–62.3

CHELSA 1981–2010, ~9 km grid, at location & month of 937 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)