Alliopsis billbergi

(Zetterstedt, 1837) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Anthomyiidae/Alliopsis

At a glance

Occurrence records404

Data sources9

Biological traits0

DNA specimens75

eDNA detections132

Sources9 archives

Databases and archives Alliopsis billbergi's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility404 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI132 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics75 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF404 records

Environmental DNA3 datasets · 8 countries132 detections

DNA & barcodingBOLD75 specimens

Genome at a glanceGoaT · NCBI≈966 Mbp

01Narrative

Alliopsis billbergi is a species of fly in the family Anthomyiidae. It is found in the Palearctic .Fauna EuropaeaBei-Bienko, G.Y. & Steyskal, G.C. (1988) Keys to the Insects of the European Part of the USSR, Volume V: Diptera and Siphonaptera, Part I. Amerind Publishing Co., New Delhi. The larvae are phytophagous.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding75 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alliopsis billbergi has left across the world's sequence archives.

At a glance

DNA specimens75

BINs1

Marker genes1

eDNA detections132

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P651 bp consensus74 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

177Tvariable

ACACTATATTTTATTTTTGGAGCATGATCAGGAATAGTAGGAACTTCCTTAAGTATTCTAATTCGAGCTGAATTAGGACATCCTGGAGCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.12%

Haplotypes4

BIN1

Most divergent pair0.31%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alliopsis silvestrissame genus4.8%Alliopsis denticaudasame genus4.8%Alliopsis fractisetasame genus5.1%Alliopsis constrictorsame genus5.2%Alliopsis teriolensissame genus5.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Alliopsis billbergi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈965 891 947 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Alliopsis billbergi0.97 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.3% BUSCO

08Occurrence & distribution

Record type404 records

Wild obs. + sensor307

Museum / vouchered97

Range

Area of Occupancy AOO1 020 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 156≤1 km 108≤10 km 41

305 georeferenced · 2 without coordinates

Open the mapobservation + sensor307

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 29≤1 km 48≤10 km 9>10 km 4

90 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence97

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	23
Iwate Prefectural Museumlocation not on record	22
Stockholm, SE	8
SLU Artdatabankenlocation not on record	6
NTNU-VMlocation not on record	4
University of Tokyo, Department of Zoologylocation not on record	3
Metsähallituslocation not on record	3
NHMOlocation not on record	2
CBDClocation not on record	1
Rovaniemi, FI	1
MZLUlocation not on record	1
ZMAAlocation not on record	1

12 institutions · 75 of 97 vouchered records shown · 22 without an institution code

09Environmental DNA132 detections

Where the DNA of Alliopsis billbergi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found132

Studies independent surveys3

Countries8

Verifiable raw sequence linked58

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 132 detections have coordinates

Open the map8 countries0

Farmland, coast and birch habitatForestHay meadowUrban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.80 °C -0.7–13.0

Seasonal swing summer↔winter19.2 °C

Max temp (day)12.3 °C 1.70–15.9

Min temp (night)3.60 °C -3.80–8.40

Precipitation66.8 mm/mo 43.4–91.2

Air humidity59.3 % 57.5–69.2

Moisture balance-17.1 mm/mo -46.5–30.1

Vapour deficit469 Pa 249–606

Wind speed2.80 m/s 1.60–4.20

Cloud cover51.3 % 39.2–65.2

CHELSA 1981–2010, ~9 km grid, at location & month of 132 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)