Allactaga williamsi

Thomas, 1897 · species

image placeholder — illustration coming later

Animalia/Chordata/Mammalia/Rodentia/Dipodidae/Allactaga

At a glance

Occurrence records4

Data sources6

Biological traits9

DNA specimens9

eDNA detections10

Sources6 archives

Databases and archives Allactaga williamsi's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF4 records

Environmental DNA1 datasets · 1 countries10 detections

DNA & barcodingBOLD9 specimens

01Narrative

Williams's jerboa (Allactaga williamsi) is a species of jerboas native to Afghanistan, Armenia, Azerbaijan, Iran and Turkey.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBEltonTraitsPanTHERIA

Size & morphology1

Body mass232 g

⚠ sources differ — AmnioteDB: 232 g · EltonTraits: 117 g

Life cycle & reproduction2

Litter size5

Max. longevity50.4 months

Diet & foraging3

Invertebrate20 %

Plant other30 %

Seed50 %

Habitat & environment1

Terrestriality-999.00

Other traits2

Activity cycle-999.00

Foraging stratumG

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allactaga williamsi has left across the world's sequence archives.

At a glance

DNA specimens9

BINs2

Marker genes1

eDNA detections10

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P632 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 34 variable positions, in barcode order

30Tmostly conserved

48Amostly conserved

54Amostly conserved

57Cmostly conserved

66Gmostly conserved

84Tmostly conserved

87Amostly conserved

138Avariable

165Gmostly conserved

231Tmostly conserved

255Cvariable

264Cmostly conserved

297Avariable

313Cvariable

318Tmostly conserved

325Tmostly conserved

330Tmostly conserved

348Avariable

369Avariable

432Amostly conserved

441Amostly conserved

474Amostly conserved

483Cmostly conserved

489Cmostly conserved

495Cmostly conserved

513Cmostly conserved

531Tmostly conserved

552Tmostly conserved

561Cmostly conserved

564Tvariable

570Amostly conserved

585Tmostly conserved

594Gmostly conserved

600Tmostly conserved

ATAGTTGGTACAGCCCTAAGCATTCTTATTCGAGCTGAATTAGGTCAACCTGGAGCCCTAATAGGGGACGACCAAATCTACAATGTAGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.0%

Haplotypes8

BINs2

Most divergent pair4.1%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Scarturus williamsisame family3.3%Pygeretmus pumiliosame family13.9%Akodon caenosussame order14.4%Juliomys pictipessame order15.0%Allactaga severtzovisame genus15.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type4 records

Wild obs. + sensor2

Museum / vouchered2

Range

Area of Occupancy AOO16 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tacoma, US	1
Bonn, DE	1

2 institutions · 2 of 2 vouchered records shown

09Environmental DNA10 detections

Where the DNA of Allactaga williamsi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.0 °C 22.0–22.0

Seasonal swing summer↔winter27.8 °C

Max temp (day)27.6 °C

Min temp (night)13.9 °C

Precipitation5.50 mm/mo

Air humidity39.8 %

Moisture balance-124 mm/mo

Vapour deficit1,940 Pa

Wind speed2.40 m/s

Cloud cover21.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)