Akodon caenosus

Thomas, 1918 · species

image placeholder — illustration coming later

Animalia/Chordata/Mammalia/Rodentia/Cricetidae/Akodon

At a glance

Occurrence records49

Data sources7

Biological traits8

DNA specimens19

eDNA detections23

Sources7 archives

Databases and archives Akodon caenosus's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility49 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Occurrence & distributionGBIF49 records

Environmental DNA1 datasets · 0 countries23 detections

DNA & barcodingBOLD19 specimens

01Narrative

Akodon caenosus is a rodent in the genus Akodon found in northwestern Argentina and south-central Bolivia. Since its description in 1918, it has been alternatively classified as a separate species or a subspecies of Akodon lutescens (formerly Akodon puer). The species Akodon aliquantulus, described from some very small Argentine specimens in 1999, is now recognized as a synonym of A. caenosus. Akodon caenosus is very small, averaging 19.3 g in weight, and variable in coloration, but generally brown. The underparts are sharply different in color from the upperparts. The skull has a short rostrum (front part), broad interorbital region (between the eyes), and narrow braincase. The karyotype includes 34 chromosomes. A. caenosus mostly occurs in Yungas vegetation and breeds mainly during the winter. It shares its range with many other sigmodontine rodents, including three other species of Akodon.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBEltonTraitsPanTHERIA

Size & morphology2

Body mass26.73 g

⚠ sources differ — AmnioteDB: 26.73 g · EltonTraits: 31.32 g

SVL14 cm

Life cycle & reproduction1

Litter size4.18

Diet & foraging2

Invertebrate70 %

Plant other30 %

Habitat & environment1

Terrestriality-999.00

Other traits2

Activity cycle-999.00

Foraging stratumG

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Akodon caenosus has left across the world's sequence archives.

At a glance

DNA specimens19

BINs2

Marker genes1

eDNA detections23

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

2Cmostly conserved

11Tmostly conserved

98Gvariable

212Tmostly conserved

320Gmostly conserved

341Cmostly conserved

357Tmostly conserved

470Tvariable

614Cmostly conserved

653Amostly conserved

CCCTATACCTTATCTTTGGTGCCTGAGCGGGCATAGTAGGAACAGCCCTAAGCATCCTAATCCGAGCTGAACTAGGACAACCCGGCGCCC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes6

BINs2

Most divergent pair7.3%

S.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Akodon fumeussame genus5.3%Akodon spegazziniisame genus6.7%Akodon polopisame genus6.7%Akodon azaraesame genus8.4%Akodon montensissame genus8.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

07Deep time~0.73 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin0.73 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type49 records

Museum / vouchered49

Range

Area of Occupancy AOO44 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 11

12 georeferenced · 37 without coordinates

Open the institutions mapphysical evidence49

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Buenos Aires, AR	47
Cambridge, US	1
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1

3 institutions · 49 of 49 vouchered records shown

09Environmental DNA23 detections

Where the DNA of Akodon caenosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)