Alepocephalus productus

Gill, 1883 · species

image placeholder — illustration coming later

Animalia/Chordata/Osmeriformes/Alepocephalidae/Alepocephalus

At a glance

Occurrence records404

Data sources8

Biological traits7

DNA specimens14

eDNA detections362

Sources8 archives

Databases and archives Alepocephalus productus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility133 records↗

OBISOcean Biodiversity Information System271 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI362 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS404 records

Environmental DNA2 datasets · 1 countries362 detections

DNA & barcodingBOLD14 specimens

01Narrative

Alepocephalus productus is een straalvinnige vissensoort uit de familie van gladkopvissen (Alepocephalidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1883 door Gill.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length41 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebathydemersal

Uses & economy1

Commercial importanceof no interest

Other traits3

Depth max3 500 m

Depth min815 m

Vulnerability40.01

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alepocephalus productus has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes11

eDNA detections362

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P671 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.37%

Haplotypes2

BIN1

Most divergent pair0.45%

Where individuals differ — all 4 variable positions, in barcode order

1Gvariable

3Cvariable

6Tvariable

225Amostly conserved

GACATTGGCACCCTTTATTTAGTATTCGGTGCCTGAGCCGGAATAGTTGGCACGGCTCTCAGTCTCTTAATTCGAGCCGAGCTAAGCCAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alepocephalus triangularissame genus1.7%Alepocephalus australissame genus2.1%Alepocephalus tenebrosussame genus2.3%Alepocephalus bairdiisame genus2.5%Alepocephalus antipodianussame genus2.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_013570 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTBs-rRNAl-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type404 records

Wild obs. + sensor18

Museum / vouchered254

Other132

Origin

Native7

Range

Area of Occupancy AOO568 km²

Depth

0–200 m sunlit0

200–1000 m twilight61

1–4 km midnight133

>4 km abyssal0

median 1 008 m · max 3 027.5 m · 194 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 4

4 georeferenced · 14 without coordinates

Open the mapobservation + sensor18

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 16

19 georeferenced · 235 without coordinates

Open the institutions mapphysical evidence254

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	12
Bergen, NO	11
Texas Cooperative Wildlife Collectionlocation not on record	7
FishBaselocation not on record	5
New Haven, US	4
Zoologisches Museum Hamburglocation not on record	4
IEO-COMA-CSIClocation not on record	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	4
Paris, FR	4
University of Texas Biodiversity Collections (UTBC)location not on record	3
College Station, US	2
Washington, US	2
Copenhagen, DK	1
Chicago, US	1

14 institutions · 64 of 254 vouchered records shown · 13 without an institution code

09Environmental DNA362 detections

Where the DNA of Alepocephalus productus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found362

Studies independent surveys2

Countries1

Verifiable raw sequence linked355

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 362 detections have coordinates

Open the map1 country0

Atlantic Ocean

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.8 °C 12.2–17.0

Seasonal swing summer↔winter18.0 °C

Max temp (day)16.2 °C 13.7–18.7

Min temp (night)13.9 °C 11.0–16.2

Precipitation102 mm/mo 89.3–134

Air humidity68.3 % 61.1–73.9

Vapour deficit546 Pa 463–610

Cloud cover43.2 % 38.9–51.9

CHELSA 1981–2010, ~9 km grid, at location & month of 362 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)