Alepocephalus australis

Barnard, 1923 · species

image placeholder — illustration coming later

Animalia/Chordata/Osmeriformes/Alepocephalidae/Alepocephalus

At a glance

Occurrence records8 003

Data sources8

Biological traits7

DNA specimens23

eDNA detections82

Sources8 archives

Databases and archives Alepocephalus australis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 969 records↗

OBISOcean Biodiversity Information System4 034 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI82 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS8 003 records

Environmental DNA2 datasets · 4 countries82 detections

DNA & barcodingBOLD23 specimens

01Narrative

Alepocephalus australis is een straalvinnige vissensoort uit de familie van gladkopvissen (Alepocephalidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1923 door Barnard.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length69 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebathydemersal

Uses & economy1

Commercial importanceof potential interest

Other traits3

Depth max2 600 m

Depth min1 000 m

Vulnerability53.67

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alepocephalus australis has left across the world's sequence archives.

At a glance

DNA specimens23

BINs2

Marker genes11

eDNA detections82

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 31 variable positions, in barcode order

49Cvariable

73Tmostly conserved

106Amostly conserved

178Avariable

214Gvariable

265Amostly conserved

286Tvariable

289Tmostly conserved

295Tvariable

298Gvariable

307Avariable

310Cvariable

313Avariable

316Gvariable

325Gvariable

328Gvariable

358Gvariable

391Cmostly conserved

403Cvariable

404Cmostly conserved

406Avariable

418Cmostly conserved

439Cvariable

448Cmostly conserved

466Avariable

505Gvariable

523Gvariable

580Cvariable

589Cvariable

616Gvariable

643Cvariable

CCTTTATTTAGTATTCGGTGCCTGAGCCGGAATAGTTGGCACGGCTCTCAGCCTCTTAATTCGAGCCGAGCTTAGCCAGCCCGGCGCCCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.1%

Haplotypes6

BINs2

Most divergent pair3.8%

OtherOceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alepocephalus triangularissame genus2.0%Alepocephalus productussame genus2.1%Alepocephalus owstonisame genus2.8%Alepocephalus tenebrosussame genus2.9%Alepocephalus antipodianussame genus2.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_013566 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTBs-rRNAl-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type8 003 records

Wild obs. + sensor7 368

Museum / vouchered588

Other47

Origin

Native4

Range

Area of Occupancy AOO11 740 km²

Depth

0–200 m sunlit2

200–1000 m twilight1 077

1–4 km midnight2 776

>4 km abyssal0

median 1 071.8 m · max 2 976 m · 3 855 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 7 046≤1 km 262>10 km 2

7 310 georeferenced · 58 without coordinates

Open the mapobservation + sensor7 368

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy79% within 1 km

≤100 m 48≤1 km 106≤10 km 31>10 km 9

194 georeferenced · 394 without coordinates

Open the institutions mapphysical evidence588

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Fish Collectionlocation not on record	64
FishBaselocation not on record	32
Cambridge, US	23
Museums Victorialocation not on record	17
Sydney, AU	14
New Haven, US	11
Washington, US	11
ICM-CSIClocation not on record	10
Zoologisches Museum Hamburglocation not on record	10
Wuzhou, CN	10
South Kensington, GB	10
Bergen, NO	10
South African Institute for Aquatic Biodiversitylocation not on record	9
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	6
CASlocation not on record	4
CSIRO, Australian National Fish Collectionlocation not on record	3
The Atlantic reference Centrelocation not on record	2
Los Angeles, US	2
Texas Cooperative Wildlife Collectionlocation not on record	2
IEO-COMA-CSIClocation not on record	2
University of Texas Biodiversity Collections (UTBC)location not on record	2
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	2
Chicago, US	2
Auckland, NZ	1
Chinese Academy of Sciences, Institute of Oceanologylocation not on record	1

25 institutions · 260 of 588 vouchered records shown · 16 without an institution code

09Environmental DNA82 detections

Where the DNA of Alepocephalus australis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found82

Studies independent surveys2

Countries4

Verifiable raw sequence linked71

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 82 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.9 °C 12.2–18.2

Seasonal swing summer↔winter18.0 °C

Max temp (day)16.2 °C 13.7–19.2

Min temp (night)14.1 °C 11.0–17.5

Precipitation102 mm/mo 89.7–134

Air humidity68.3 % 61.1–73.9

Vapour deficit546 Pa 470–630

Cloud cover43.2 % 37.8–49.8

CHELSA 1981–2010, ~9 km grid, at location & month of 77 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Alepocephalus australis

At a glance

Sources8 archives

Size & morphology1

Habitat & environment2

Uses & economy1

Other traits3

At a glance

Record type8 003 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 25 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type8 003 records