Alepes apercna

Grant, 1987 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Carangidae/Alepes

At a glance

Occurrence records2 169

Data sources9

Biological traits7

DNA specimens13

eDNA detections14

Sources9 archives

Databases and archives Alepes apercna's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility639 records↗

OBISOcean Biodiversity Information System1 530 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS2 169 records

Environmental DNA1 datasets · 2 countries14 detections

DNA & barcodingBOLD13 specimens

01Narrative

The smallmouth scad (Alepes apercna) (also known as the banded scad and roundfin trevally), is a species of tropical marine fish in the jack family Carangidae. The species is endemic to northern Australia, inhabiting primarily inshore waters. It is similar to other scads in the genus Alepes, and is distinguished by a well-developed posterior adipose eyelid, as well as fin membrane spotting and gill raker counts. It is not a large species, with the maximum length reported to be 29.5 cm. It feeds primarily on a variety of small invertebrates, and is of very minor economic importance.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length29.5 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Uses & economy1

Commercial importancecommercial

Other traits3

Depth max80 m

Depth min5 m

Vulnerability19.5

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alepes apercna has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

eDNA detections14

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P648 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

12Amostly conserved

42Amostly conserved

114Tmostly conserved

147Gmostly conserved

201Cmostly conserved

234Tmostly conserved

321Amostly conserved

372Avariable

384Cmostly conserved

615Tmostly conserved

ACCCTTTATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGAACAGCTTTAAGCCTCCTTATCCGAGCAGAACTTAGTCAACCTGGCGCC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.28%

Haplotypes7

BIN1

Most divergent pair0.93%

AsiaOceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alepes varisame genus2.9%Alepes melanopterasame genus3.1%Atule matesame family10.0%Pantolabus radiatussame family10.0%Caranx sexfasciatussame family11.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 169 records

Wild obs. + sensor1 497

Museum / vouchered669

Other3

Range

Area of Occupancy AOO3 168 km²

Depth

0–200 m sunlit1 115

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 23.1 m · max 125 m · 1 115 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 101≤1 km 1 378≤10 km 2>10 km 3

1 484 georeferenced · 13 without coordinates

Open the mapobservation + sensor1 497

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 25≤1 km 101≤10 km 370>10 km 18

514 georeferenced · 155 without coordinates

Open the institutions mapphysical evidence669

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DEWlocation not on record	178
Australian National Fish Collectionlocation not on record	42
Natick, US	27
Museum and Art Gallery of the Northern Territorylocation not on record	22
Sydney, AU	12
Western Australian Museumlocation not on record	10
Curtin Universitylocation not on record	4
Museums Victorialocation not on record	1
Washington, US	1
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	1

10 institutions · 298 of 669 vouchered records shown

09Environmental DNA14 detections

Where the DNA of Alepes apercna was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median28.1 °C 26.0–28.1

Seasonal swing summer↔winter4.40 °C

Max temp (day)31.9 °C 27.6–31.9

Min temp (night)23.6 °C

Precipitation137 mm/mo

Air humidity59.8 % 59.8–60.1

Moisture balance-8.90 mm/mo -8.90–19.6

Vapour deficit1,523 Pa 1,330–1,523

Wind speed2.20 m/s 2.20–3.00

Cloud cover38.6 % 29.3–38.6

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Alepes apercna

At a glance

Sources9 archives

Size & morphology1

Habitat & environment2

Uses & economy1

Other traits3

At a glance

Record type2 169 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 10 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 169 records