Alcathoe carolinensis

Engelhardt, 1925 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Sesiidae/Alcathoe

At a glance

Occurrence records27

Data sources7

Biological traits0

DNA specimens4

eDNA detections2

Sources7 archives

Databases and archives Alcathoe carolinensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility27 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF27 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD4 specimens

01Narrative

Alcathoe carolinensis is een vlinder uit de familie wespvlinders (Sesiidae), onderfamilie Sesiinae. Alcathoe carolinensis is voor het eerst wetenschappelijk beschreven door Engelhardt in 1925. De soort komt voor in het Nearctisch gebied.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alcathoe carolinensis has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections2

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.23%

Haplotypes1

BIN1

Where individuals differ — all 3 variable positions, in barcode order

235Tmostly conserved

409Gmostly conserved

565Amostly conserved

AACCTTATATTTTATCTTTGGTATTTGAGCAGGAATGGTGGGTACAACTTTAAGCCTCTTAATTCGTGCTGAATTAGGTACTCCGGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alcathoe pepsioidessame genus4.4%Bembecia illustrissame family9.7%Carmenta guatemalenasame family9.9%Apethistis insulsasame order10.5%Barea pissinasame order10.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type27 records

Wild obs. + sensor10

Museum / vouchered17

Range

Area of Occupancy AOO64 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 4≤1 km 3>10 km 1

8 georeferenced · 2 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤1 km 2≤10 km 12>10 km 1

15 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ASUlocation not on record	6
Mississippi State, US	4
East Lansing, US	4
Georgia Museum of Natural Historylocation not on record	2
St. Paul, US	1

5 institutions · 17 of 17 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Alcathoe carolinensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)