Apethistis insulsa — The Life Data

Animalia/Arthropoda/Insecta/Lepidoptera/Autostichidae/Apethistis

At a glance

Occurrence records0

Data sources4

Biological traits0

DNA specimens5

eDNA detections0

Sources4 archives

Databases and archives Apethistis insulsa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page2 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

DNA & barcodingBOLD5 specimens

01Narrative

Brachmia insulsa is a moth in the family Gelechiidae. It was described by Edward Meyrick in 1914. It is found in the Bengal region of what was then British India and the United Arab Emirates. The wingspan is 12–16 mm. The forewings are light greyish ochreous with the stigmata dark fuscous, the plical slightly before the first discal. There are some cloudy dark-fuscous dots around the apex and termen, sometimes almost obsolete. The hindwings are ochreous-grey whitish.Journal of the Bombay Natural History Society. 22 (4): 774.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apethistis insulsa has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.06%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

646Tmostly conserved

TACATTATATTTTATTTTTGGAATTTGATCAGGTATAGTAGGAACTTCTTTAAGTCTTCTCATTCGTGCAGAATTAGGTAATCCTGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Bocana manifestalissame order8.7%Ceratarcha umbrosasame order8.8%Acontia insociasame order8.8%Acontia micropterasame order9.0%Argidia subvelatasame order9.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5P

animal barcode