Alburnoides holciki

Coad & Bogutskaya, 2012 · species

image placeholder — illustration coming later

Animalia/Chordata/Cypriniformes/Cyprinidae/Alburnoides

At a glance

Occurrence records85

Data sources7

Biological traits5

DNA specimens69

eDNA detections76

Sources7 archives

Databases and archives Alburnoides holciki's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility85 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI76 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics69 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF85 records

Environmental DNA1 datasets · 2 countries76 detections

DNA & barcodingBOLD69 specimens

01Narrative

Alburnoides holciki is a species of small (10.2 cm max length) freshwater fish in the family Cyprinidae. It was endemic to the Hari River drainage in northwestern Afghanistan, northeastern Iran, and southern Turkmenistan. Recent studies have shown that this species is also found in the Amu Darya basin in Tajikistan and Uzbekistan.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology2

Body length10.18 cm

Body mass19.8 g

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Other traits1

Vulnerability10

05DNA & barcoding69 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alburnoides holciki has left across the world's sequence archives.

At a glance

DNA specimens69

BINs1

Marker genes1

eDNA detections76

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P626 bp consensus69 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

6Tmostly conserved

114Tmostly conserved

291Tmostly conserved

609Avariable

TTTGGTGCCTGGGCTGGAATAGTGGGGACTGCCTTAAGCCTCCTTATTCGGGCCGAACTAAGCCAACCCGGGTCACTTTTAGGAGATGAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.43%

Haplotypes18

BIN1

Most divergent pair0.96%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alburnoides gmelinisame genus5.1%Alburnoides kubanicussame genus5.3%Alburnoides fasciatussame genus5.8%Alburnoides namakisame genus6.1%Alburnoides idignensissame genus6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type85 records

Wild obs. + sensor16

Museum / vouchered69

Range

Area of Occupancy AOO140 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 15

15 georeferenced · 1 without coordinates

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 69 records without

Open the institutions mapphysical evidence69

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Staatliches Naturhistorisches Museum - Braunschweiglocation not on record	1

2 institutions · 2 of 69 vouchered records shown · 67 without an institution code

09Environmental DNA76 detections

Where the DNA of Alburnoides holciki was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found76

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 76 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.4 °C 17.8–32.7

Seasonal swing summer↔winter27.8 °C

Max temp (day)33.2 °C 24.0–39.8

Min temp (night)19.9 °C 11.0–24.9

Precipitation1.70 mm/mo 0.3–8.10

Air humidity42.5 % 37.0–49.4

Moisture balance-165 mm/mo -259–-98.2

Vapour deficit1,940 Pa 1,056–3,099

Wind speed2.70 m/s 1.50–5.50

Cloud cover8.70 % 7.30–13.5

CHELSA 1981–2010, ~9 km grid, at location & month of 72 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)