Alburnoides gmelini

Bogutskaya & Coad, 2009 · species

image placeholder — illustration coming later

Animalia/Chordata/Cypriniformes/Cyprinidae/Alburnoides

At a glance

Occurrence records18

Data sources8

Biological traits4

DNA specimens9

eDNA detections11

Sources8 archives

Databases and archives Alburnoides gmelini's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility18 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF18 records

Environmental DNA1 datasets · 2 countries11 detections

DNA & barcodingBOLD9 specimens

01Narrative

Alburnoides gmelini, the Dagestan spirlin, is a fish species of the family Cyprinidae, known from the western Caspian coast of southern Russia. I can be differentiated from its cogenerates by differences in fin ray and vertebral counts, together with other morphological characters.Bogutskaya, N. G., and B. W. Coad. "A review of vertebral and fin-ray counts in the genus Alburnoides (Teleostei: Cyprinidae) with a description of six new species." Zoosystematica Rossica 18.1 (2009): 126-173. The specific bane honors Samuel Gottlieb Gmelin, a Russian-German naturalist who traveled through the River Don area and the Caucasus region and along the western and southern Caspian Sea coasts between 1768 and 1774.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length8.31 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Other traits1

Vulnerability10

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alburnoides gmelini has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections11

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P651 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

177Amostly conserved

222Tmostly conserved

249Amostly conserved

336Cmostly conserved

474Tmostly conserved

495Tvariable

498Cmostly conserved

CTTTATCTTGTATTTGGTGCCTGGGCCGGAATAGTGGGGACTGCCTTAAGCCTCCTTATTCGGGCCGAACTAAGCCAACCCGGGTCACTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.32%

Haplotypes7

BIN1

Most divergent pair0.61%

AsiaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alburnoides eichwaldiisame genus3.4%Alburnoides namakisame genus3.5%Alburnoides damghanisame genus3.5%Alburnoides nicolausisame genus3.7%Alburnoides idignensissame genus3.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type18 records

Wild obs. + sensor2

Museum / vouchered16

Range

Area of Occupancy AOO20 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 16 records without

Open the institutions mapphysical evidence16

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bonn, DE	16

1 institutions · 16 of 16 vouchered records shown

09Environmental DNA11 detections

Where the DNA of Alburnoides gmelini was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C -2.20–16.5

Seasonal swing summer↔winter25.0 °C

Max temp (day)20.3 °C 1.70–21.0

Min temp (night)10.3 °C -7.00–12.0

Precipitation34.2 mm/mo 31.5–36.6

Air humidity60.2 % 56.1–60.4

Moisture balance-49.1 mm/mo -66.2–-10.1

Vapour deficit917 Pa 364–936

Wind speed2.10 m/s 1.50–2.40

Cloud cover38.4 % 36.3–58.5

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)