Albuna pyramidalis

(Walker, 1856) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Sesiidae/Albuna

At a glance

Occurrence records1 442

Data sources8

Biological traits0

DNA specimens51

eDNA detections49

Sources8 archives

Databases and archives Albuna pyramidalis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 442 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI49 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics51 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 442 records

Environmental DNA1 datasets · 2 countries49 detections

DNA & barcodingBOLD51 specimens

01Narrative

Albuna pyramidalis, the fireweed clearwing moth, is a species of clearwing moth in the family Sesiidae. The MONA or Hodges number for Albuna pyramidalis is 2533. Fireweed clearwing moth, Albuna pyramidalis Fireweed clearwing moth, Albuna pyramidalis

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding51 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Albuna pyramidalis has left across the world's sequence archives.

At a glance

DNA specimens51

BINs2

Marker genes1

eDNA detections49

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus49 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

79Avariable

85Amostly conserved

100Amostly conserved

181Gmostly conserved

205Tmostly conserved

214Amostly conserved

229Avariable

268Tmostly conserved

322Amostly conserved

325Gmostly conserved

355Tvariable

370Gmostly conserved

409Gmostly conserved

430Gmostly conserved

451Gmostly conserved

481Amostly conserved

490Cmostly conserved

565Tmostly conserved

631Gmostly conserved

634Tmostly conserved

TACATTATATTTTATTTTTGGTATTTGATCTGGAATAGTGGGAACTTCTTTAAGTCTTTTAATTCGAGCTGAATTAGGAATACCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes23

BINs2

Most divergent pair2.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Albuna fraxinisame genus6.5%Albuna beutenmuellerisame genus8.1%Euhagena palariformissame family8.2%Siglophora ferreiluteasame order10.9%Hemiceras ceibasame order11.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 442 records

Wild obs. + sensor1 049

Museum / vouchered393

Range

Area of Occupancy AOO3 824 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 549≤1 km 140≤10 km 83>10 km 46

818 georeferenced · 231 without coordinates

Open the mapobservation + sensor1 049

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 29≤1 km 50≤10 km 45>10 km 18

142 georeferenced · 251 without coordinates

Open the institutions mapphysical evidence393

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Vancouver, CA	64
Edmonton, CA	59
Royal Saskatchewan Museumlocation not on record	51
New Haven, US	43
East Lansing, US	31
Vernal, US	28
University of Alberta Museums (UAM)location not on record	26
Washington, US	16
University of Guelph, Centre for Biodiversity Genomicslocation not on record	12
San Diego, US	11
St. Paul, US	11
Colorado State Universitylocation not on record	6
University of Alaska Museumlocation not on record	4
DOI/FWS, Kenai National Wildlife Refugelocation not on record	2
Chicago, US	2
Georgia Museum of Natural Historylocation not on record	1
KWPlocation not on record	1
Universidad Católica de Manizaleslocation not on record	1

18 institutions · 369 of 393 vouchered records shown · 24 without an institution code

09Environmental DNA49 detections

Where the DNA of Albuna pyramidalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found49

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 49 detections have coordinates

Open the map2 countries0

Forest1. Forest & Woodland | 1.1 Forest - BorealGrasslandMixed HabitatPost-fire forestRiparian Zone

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.1 °C 10.2–17.4

Seasonal swing summer↔winter32.8 °C

Max temp (day)19.8 °C 14.2–22.7

Min temp (night)9.80 °C 6.20–13.1

Precipitation88.0 mm/mo 62.9–122

Air humidity57.7 % 52.9–62.6

Moisture balance-15.7 mm/mo -63.6–17.4

Vapour deficit688 Pa 466–884

Wind speed2.40 m/s 1.40–4.10

Cloud cover44.2 % 32.9–60.3

CHELSA 1981–2010, ~9 km grid, at location & month of 44 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Albuna pyramidalis

At a glance

Sources8 archives

At a glance

Record type1 442 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 442 records