Albuna fraxini

(Edwards, 1881) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Sesiidae/Albuna

At a glance

Occurrence records1 153

Data sources8

Biological traits0

DNA specimens13

eDNA detections12

Sources8 archives

Databases and archives Albuna fraxini's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 153 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 153 records

Environmental DNA1 datasets · 2 countries12 detections

DNA & barcodingBOLD13 specimens

01Narrative

Albuna fraxini, the Virginia creeper clearwing, is a moth of the family Sesiidae. It is known from the northern United States and southern Canada.Bug Guide Life Cycle Larva The wingspan is about 18 mm.mothphotographersgroup Adults are on wing from June to August. Adults generally only live for a week. Females emit pheromones to attract mates soon after emerging from pupae. The larvae feed on Virginia creeper, white, red, green, and European ash, and sometimes mountain-ash.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Albuna fraxini has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

eDNA detections12

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

64Tmostly conserved

100Amostly conserved

325Tmostly conserved

352Gmostly conserved

403Amostly conserved

410Gmostly conserved

412Amostly conserved

517Amostly conserved

520Gmostly conserved

613Tmostly conserved

625Gmostly conserved

AACATTATATTTTATTTTTGGTGTTTGATCTGGAATAGTAGGAACTTCTTTAAGTCTTTTAATTCGAGCTGAATTAGGGATACCTGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.29%

Haplotypes3

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Albuna pyramidalissame genus6.5%Euhagena palariformissame family7.9%Albuna beutenmuellerisame genus8.4%Trisyntopa scatophagasame order10.5%Afrasura ichorinasame order11.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 153 records

Wild obs. + sensor799

Museum / vouchered354

Range

Area of Occupancy AOO2 656 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 388≤1 km 174≤10 km 51>10 km 89

702 georeferenced · 97 without coordinates

Open the mapobservation + sensor799

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy15% within 1 km

≤100 m 3≤1 km 32≤10 km 198>10 km 5

238 georeferenced · 116 without coordinates

Open the institutions mapphysical evidence354

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	220
St. Paul, US	56
Cornell University Insect Collectionlocation not on record	51
King Saud Universitylocation not on record	5
New Haven, US	4
Washington, US	4
University Park, US	4
Colorado State Universitylocation not on record	3
University of Guelphlocation not on record	2
Georgia Museum of Natural Historylocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

11 institutions · 351 of 354 vouchered records shown · 3 without an institution code

09Environmental DNA12 detections

Where the DNA of Albuna fraxini was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map2 countries0

Mixed habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.2 °C 20.5–22.5

Seasonal swing summer↔winter27.2 °C

Max temp (day)25.6 °C 25.1–26.3

Min temp (night)17.0 °C 15.6–20.4

Precipitation93.3 mm/mo 87.0–105

Air humidity58.0 % 57.2–59.1

Moisture balance-60.8 mm/mo -99.4–-47.6

Vapour deficit1,062 Pa 1,027–1,118

Wind speed3.40 m/s 3.20–5.40

Cloud cover37.8 % 36.0–45.1

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Albuna fraxini

At a glance

Sources8 archives

At a glance

Record type1 153 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 11 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 153 records