Alaus oculatus

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Elateridae/Alaus

At a glance

Occurrence records14 834

Data sources10

Biological traits0

DNA specimens13

eDNA detections13

Sources10 archives

Databases and archives Alaus oculatus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility14 834 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Occurrence & distributionGBIF14 834 records

Environmental DNA1 datasets · 2 countries13 detections

DNA & barcodingBOLD13 specimens

Genome at a glanceGoaT · NCBI≈7 Mbp

01Narrative

Alaus oculatus, commonly called the eastern eyed click beetle or eyed elater, is a species of click beetle. Alaus oculatus, preserved specimen

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alaus oculatus has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

eDNA detections13

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

166Amostly conserved

268Cmostly conserved

313Cmostly conserved

346Tmostly conserved

382Tmostly conserved

401Cmostly conserved

409Gmostly conserved

428Cmostly conserved

451Tmostly conserved

487Tmostly conserved

568Amostly conserved

637Amostly conserved

AACCCTTTATTTTCTTTTCGGTGCATGAGCCGGAATACTAGGGACATCACTAAGATTATTGATCCGAGCCGAACTCGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.41%

Haplotypes6

BIN1

Most divergent pair0.91%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alaus melanopssame genus6.5%Chalcolepidius oxydatussame family12.6%Cryptalaus yamatosame family13.2%Chalcolepidius gossipiatussame family13.5%Chalcolepidius validussame family13.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Alaus oculatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈7 311 681 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Alaus oculatus0.0073 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type14 834 records

Wild obs. + sensor14 620

Museum / vouchered214

Range

Area of Occupancy AOO43 756 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 8 777≤1 km 1 733≤10 km 938>10 km 1 402

12 850 georeferenced · 1 770 without coordinates

Open the mapobservation + sensor14 620

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤100 m 11≤1 km 13≤10 km 71>10 km 20

115 georeferenced · 99 without coordinates

Open the institutions mapphysical evidence214

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Lexington, US	46
Wuzhou, CN	31
University Park, US	18
UDlocation not on record	13
University of Central Floridalocation not on record	13
Toronto, CA	7
Natural History Museum of Utahlocation not on record	7
College Station, US	6
Cornell University Insect Collectionlocation not on record	6
University of Guelphlocation not on record	6
Champaign, US	5
ASUlocation not on record	5
MAJClocation not on record	4
University of Tennessee at Chattanoogalocation not on record	4
CUlocation not on record	4
National Institute of Biological Resourceslocation not on record	3
Lubbock, US	3
Cambridge, US	2
Chicago, US	2
Cleveland Museum of Natural History, OH (CLEV)location not on record	2
Washington, US	2
AHABlocation not on record	2
New Haven, US	2
SOVTlocation not on record	2
Universidad Católica de Manizaleslocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
Awka, NG	1
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1
OSUClocation not on record	1
Espace pour la vielocation not on record	1
San Luis Potosí, MX	1
Albuquerque, US	1
Lake Placid, US	1
Natural History Museum Rotterdamlocation not on record	1
Denton, US	1
Centre for Biodiversity Genomicslocation not on record	1
Saint John, CA	1
Mayagüez, PR	1
Royal Ontario Museumlocation not on record	1
WIlocation not on record	1

40 institutions · 213 of 214 vouchered records shown · 1 without an institution code

09Environmental DNA13 detections

Where the DNA of Alaus oculatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map2 countries0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.4 °C 20.5–23.4

Seasonal swing summer↔winter16.9 °C

Max temp (day)29.0 °C 24.5–29.0

Min temp (night)18.5 °C 15.9–21.3

Precipitation99.3 mm/mo 91.2–118

Air humidity58.8 % 58.2–60.6

Moisture balance-59.1 mm/mo -84.6–-34.9

Vapour deficit1,179 Pa 971–1,179

Wind speed1.90 m/s 1.80–5.10

Cloud cover38.0 % 29.1–39.0

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Alaus oculatus

At a glance

Sources10 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type14 834 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions18 of 40 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type14 834 records