Alaus melanops

LeConte, 1863 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Elateridae/Alaus

At a glance

Occurrence records689

Data sources6

Biological traits0

DNA specimens7

eDNA detections3

Sources6 archives

Databases and archives Alaus melanops's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility689 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF689 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD7 specimens

01Narrative

Alaus melanops is een keversoort uit de familie kniptorren (Elateridae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1863 door LeConte.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alaus melanops has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections3

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P643 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.08%

Haplotypes2

BIN1

Most divergent pair0.16%

Where individuals differ — all 1 variable positions, in barcode order

226Gmostly conserved

TTTCGGTGCATGAGCCGGAATACTAGGGACATCACTAAGATTATTGATCCGAGCCGAACTCGGTAATCCTGGATCTCTAATCGGAAATGA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alaus oculatussame genus6.5%Agrypnus scrofasame family12.8%Chalcolepidius gossipiatussame family12.9%Agrypnus tsukamotoisame family13.2%Chalcolepidius oxydatussame family13.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type689 records

Wild obs. + sensor664

Museum / vouchered25

Range

Area of Occupancy AOO2 280 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 354≤1 km 64≤10 km 52>10 km 43

513 georeferenced · 151 without coordinates

Open the mapobservation + sensor664

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy18% within 1 km

≤100 m 2≤10 km 7>10 km 2

11 georeferenced · 14 without coordinates

Open the institutions mapphysical evidence25

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santa Barbara Museum of Natural Historylocation not on record	11
San Luis Potosí, MX	2
US	2
University Park, US	2
Albuquerque, US	1
Chicago, US	1
Cambridge, US	1
CUlocation not on record	1
Awka, NG	1
Denver, US	1
Lexington, US	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1

12 institutions · 25 of 25 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Alaus melanops was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.5 °C 10.5–10.5

Seasonal swing summer↔winter23.1 °C

Max temp (day)15.9 °C

Min temp (night)3.70 °C

Precipitation39.7 mm/mo

Air humidity51.8 %

Moisture balance-88.8 mm/mo

Vapour deficit613 Pa

Wind speed3.90 m/s

Cloud cover40.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)