Agyneta unimaculata

(Banks, 1892) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Linyphiidae/Agyneta

At a glance

Occurrence records325

Data sources7

Biological traits0

DNA specimens29

eDNA detections31

Sources7 archives

Databases and archives Agyneta unimaculata's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility325 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI31 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF325 records

Environmental DNA1 datasets · 2 countries31 detections

DNA & barcodingBOLD29 specimens

01Narrative

Agyneta unimaculata is a species of sheet weaver found in Canada and the United States. It was described by Banks in 1892.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agyneta unimaculata has left across the world's sequence archives.

At a glance

DNA specimens29

BINs1

Marker genes1

eDNA detections31

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus29 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

1Amostly conserved

145Gmostly conserved

166Gmostly conserved

169Gmostly conserved

172Cmostly conserved

181Cmostly conserved

217Cmostly conserved

325Tmostly conserved

364Amostly conserved

472Gmostly conserved

484Tmostly conserved

490Gmostly conserved

532Cmostly conserved

616Cmostly conserved

628Amostly conserved

AAGTTTATATTTTATTTTTGGTGCTTGAGCAGCTATAGTTGGAACGGCAATAAGAGTTCTTATTCGAATTGAATTAGGTCAAGTTGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes6

BIN1

Most divergent pair12.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agyneta serratasame genus10.6%Agyneta parvasame genus10.8%Agyneta micariasame genus11.6%Agyneta resslisame genus11.7%Ceratinops littoralissame family12.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type325 records

Wild obs. + sensor1

Museum / vouchered324

Range

Area of Occupancy AOO312 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 1>10 km 1

3 georeferenced · 321 without coordinates

Open the institutions mapphysical evidence324

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ohio State University Acarology Laboratorylocation not on record	125
Chicago, US	117
Cambridge, US	67
University of Guelph, Centre for Biodiversity Genomicslocation not on record	10
Biodiversity Institute of Ontariolocation not on record	3
McGill Universitylocation not on record	1
Espace pour la vielocation not on record	1

7 institutions · 324 of 324 vouchered records shown

09Environmental DNA31 detections

Where the DNA of Agyneta unimaculata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found31

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 31 detections have coordinates

Open the map2 countries0

BogAgriculturalTemperate mixed forestForest14. Artificial - Terrestrial | 14.2 Pasturel…Mixed habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.9 °C 9.90–23.5

Seasonal swing summer↔winter26.2 °C

Max temp (day)24.2 °C 14.2–27.8

Min temp (night)16.1 °C 7.00–19.9

Precipitation93.6 mm/mo 78.7–109

Air humidity58.7 % 56.8–60.7

Moisture balance-51.5 mm/mo -97.2–-4.10

Vapour deficit914 Pa 491–1,141

Wind speed3.60 m/s 2.10–6.10

Cloud cover40.1 % 36.5–49.5

CHELSA 1981–2010, ~9 km grid, at location & month of 31 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)