Agyneta micaria

(Emerton, 1882) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Linyphiidae/Agyneta

At a glance

Occurrence records96

Data sources8

Biological traits0

DNA specimens18

eDNA detections18

Sources8 archives

Databases and archives Agyneta micaria's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility96 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF96 records

Environmental DNA1 datasets · 2 countries18 detections

DNA & barcodingBOLD18 specimens

01Narrative

Agyneta micaria is a species of sheet weaver found in the United States and Canada. It was described by Emerton in 1882.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agyneta micaria has left across the world's sequence archives.

At a glance

DNA specimens18

BINs1

Marker genes1

eDNA detections18

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

95Cmostly conserved

190Avariable

197Cmostly conserved

340Tmostly conserved

343Tvariable

346Cvariable

364Avariable

433Amostly conserved

565Gmostly conserved

625Tmostly conserved

GACTTTATATTTTATTTTTGGTGCTTGGGCTGCTATAGTTGGTACGGCAATAAGAGTTTTAATTCGAATTGAGTTGGGACAAATTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.59%

Haplotypes5

BIN1

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agyneta fabrasame genus9.6%Tennesseellum formicasame family10.6%Mecynargus morulussame family10.9%Agyneta serratasame genus11.1%Zygiella atricasame order11.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type96 records

Wild obs. + sensor8

Museum / vouchered88

Range

Area of Occupancy AOO240 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 2≤1 km 4>10 km 1

7 georeferenced · 1 without coordinates

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2>10 km 2

4 georeferenced · 84 without coordinates

Open the institutions mapphysical evidence88

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ohio State University Acarology Laboratorylocation not on record	42
Chicago, US	20
College Station, US	11
Cambridge, US	4
Denver, US	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
Royal Ontario Museumlocation not on record	2
Biodiversity Institute of Ontariolocation not on record	1

8 institutions · 84 of 88 vouchered records shown · 4 without an institution code

09Environmental DNA18 detections

Where the DNA of Agyneta micaria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map2 countries0

Agricultural1. Forest & Woodland|1.4. Temperate ForestGrasslandWetland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.8 °C 10.9–22.9

Seasonal swing summer↔winter26.2 °C

Max temp (day)22.1 °C 13.8–28.2

Min temp (night)13.3 °C 8.60–17.7

Precipitation94.5 mm/mo 84.3–138

Air humidity59.1 % 56.2–61.3

Moisture balance-27.7 mm/mo -47.0–26.5

Vapour deficit788 Pa 521–1,138

Wind speed3.50 m/s 2.00–4.40

Cloud cover40.7 % 32.8–52.6

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)