Agrotis interjectionis

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Agrotis

At a glance

Occurrence records125

Data sources7

Biological traits0

DNA specimens8

eDNA detections8

Sources7 archives

Databases and archives Agrotis interjectionis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility125 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF125 records

Environmental DNA1 datasets · 2 countries8 detections

DNA & barcodingBOLD8 specimens

01Narrative

Agrotis interjectionis is a moth of the family Noctuidae. It is found in the Northern Territory of Australia, Malaysia and from Sumatra, Java and Sulawesi to Vanuatu. The larvae are considered a pest on a wide range of tropical crops in South-East Asia, including Saccharum officinarum, Zea mays, Elaeis guineensis, Nicotiana tabacum, Arachis hypogaea, Sesamum, Hibiscus sabdariffa, Gossypium and Allium.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrotis interjectionis has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections8

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.04%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

7Gmostly conserved

AACATTGTACTTTATTTTTGGTATTTGAGCTGGTATAGTAGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrotis macrobscurasame genus2.7%Agrotis biconicasame genus2.9%Agrotis vetustasame genus2.9%Agrotis mundasame genus2.9%Agrotis cinereasame genus3.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type125 records

Wild obs. + sensor117

Museum / vouchered8

Range

Area of Occupancy AOO104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 17≤1 km 67≤10 km 24>10 km 2

110 georeferenced · 7 without coordinates

Open the mapobservation + sensor117

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the institutions mapphysical evidence8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Museums Victorialocation not on record	4
The University of the West Indies, Trinidad and Tobagolocation not on record	1
Australian National Insect Collectionlocation not on record	1

3 institutions · 6 of 8 vouchered records shown · 2 without an institution code

09Environmental DNA8 detections

Where the DNA of Agrotis interjectionis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.9 °C 24.6–28.6

Seasonal swing summer↔winter6.10 °C

Max temp (day)30.7 °C 26.5–34.0

Min temp (night)23.1 °C 20.6–24.8

Precipitation48.8 mm/mo 2.20–286

Air humidity55.4 % 50.9–65.6

Moisture balance6.80 mm/mo

Vapour deficit1,474 Pa 1,233–1,800

Wind speed2.80 m/s

Cloud cover45.5 % 25.4–54.3

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)