Agrotis fatidica

Hübner, 1824 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Agrotis

At a glance

Occurrence records1 362

Data sources7

Biological traits0

DNA specimens21

eDNA detections276

Sources7 archives

Databases and archives Agrotis fatidica's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 362 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI276 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 362 records

Environmental DNA1 datasets · 8 countries276 detections

DNA & barcodingBOLD21 specimens

01Narrative

Agrotis fatidica is a moth of the family Noctuidae. It is found in Southern and Central Europe, east through Russia to Mongolia, China and Tibet. Illustrated Female Illustrated Male The wingspan is about 40 mm. Adults are on wing from July to August depending on the location. The larvae feed on Poaceae species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrotis fatidica has left across the world's sequence archives.

At a glance

DNA specimens21

BINs1

Marker genes1

eDNA detections276

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

81Amostly conserved

433Amostly conserved

628Gmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.15%

Haplotypes4

BIN1

Most divergent pair0.30%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrotis orthogoniasame genus2.4%Agrotis vetustasame genus2.7%Agrotis rileyanasame genus2.9%Agrotis chretienisame genus3.0%Agrotis venerabilissame genus3.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 362 records

Wild obs. + sensor628

Museum / vouchered663

Other71

Origin

Native209

Range

Area of Occupancy AOO1 060 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 113≤1 km 240≤10 km 239

592 georeferenced · 36 without coordinates

Open the mapobservation + sensor628

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 54≤1 km 275≤10 km 279>10 km 5

613 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence663

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	156
Salzburg, AT	116
Zürich, CH	75
NHMOlocation not on record	35
NTNU-VMlocation not on record	34
Glarus, CH	34
Helsinki, FI	18
Dhaka, BD	16
Archäologie und Museum Baselland - Museum.BLlocation not on record	14
Tartu, EE	13
European Distributed Institute of Taxonomy (EDIT)location not on record	13
Bern, CH	12
Geneva, CH	11
Frauenfeld, CH	9
Sion, CH	8
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	7
MZLUlocation not on record	6
Tiroler Landesmuseum Ferdinandeumlocation not on record	6
Universität Zürich, Naturhistorisches Museumlocation not on record	6
SFRAlocation not on record	5
Musee d'Histoire Naturallelocation not on record	4
EGBlocation not on record	4
Naturmuseum St. Gallenlocation not on record	4
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	4
Landesmuseum Kärntenlocation not on record	3
New Haven, US	3
Naturmuseum Oltenlocation not on record	2
Tromsø, NO	2
Fribourg, CH	2

29 institutions · 622 of 663 vouchered records shown · 41 without an institution code

09Environmental DNA276 detections

Where the DNA of Agrotis fatidica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found276

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 276 detections have coordinates

Open the map8 countries0

Forest4. Native Grassland|4.1. Tundra14. Artificial - Terrestrial | 14.5 Urban Ar…17. Other

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.2 °C 11.0–11.2

Seasonal swing summer↔winter37.4 °C

Max temp (day)15.1 °C 14.9–15.1

Min temp (night)8.70 °C 8.60–8.70

Precipitation96.1 mm/mo 94.9–96.1

Air humidity61.6 % 61.6–61.8

Moisture balance20.7 mm/mo 10.2–20.7

Vapour deficit510 Pa 498–510

Wind speed2.40 m/s 2.40–3.90

Cloud cover51.0 % 47.8–51.0

CHELSA 1981–2010, ~9 km grid, at location & month of 274 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agrotis fatidica

At a glance

Sources7 archives

At a glance

Record type1 362 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 29 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 362 records