Agrotis bigramma

(Esper) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Agrotis

At a glance

Occurrence records5 199

Data sources9

Biological traits2

DNA specimens51

eDNA detections51

Sources9 archives

Databases and archives Agrotis bigramma's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 199 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI51 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics51 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF5 199 records

Environmental DNA1 datasets · 10 countries51 detections

DNA & barcodingBOLD51 specimens

Genome at a glanceGoaT · NCBI≈1.1 Gbp

01Narrative

Agrotis bigramma, the great dart, is a moth of the family Noctuidae. The species was first described by Eugenius Johann Christoph Esper in 1790. It is found from along the southern shores of the Baltic Sea to China, the Levant and North Africa. Migrants have been reported as far west as Great Britain with three in one trap at St Agnes, Isles of Scilly on 10 August 1997. Illustration The wingspan is 40–48 mm. Adults are on wing from September to December. There is one generation per year. The larvae feed on the roots of Poaceae species and other low growing herbaceous plants.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding51 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrotis bigramma has left across the world's sequence archives.

At a glance

DNA specimens51

BINs4

Marker genes1

eDNA detections51

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus49 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

55Amostly conserved

127Gmostly conserved

133Gvariable

206Cmostly conserved

268Tmostly conserved

382Tmostly conserved

406Cmostly conserved

421Tmostly conserved

466Amostly conserved

484Cmostly conserved

634Cvariable

646Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.66%

Haplotypes11

BINs4

Most divergent pair2.6%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrotis latasame genus2.3%Agrotis rileyanasame genus2.4%Agrotis cinereasame genus2.7%Agrotis venerabilissame genus2.7%Agrotis vetustasame genus2.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Agrotis bigramma carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 073 963 115 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Agrotis bigramma1.07 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.7% BUSCO

08Occurrence & distribution

Record type5 199 records

Wild obs. + sensor4 196

Museum / vouchered324

Other679

Origin

Native15

Range

Area of Occupancy AOO8 532 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 1 540≤1 km 446≤10 km 755>10 km 83

2 824 georeferenced · 1 372 without coordinates

Open the mapobservation + sensor4 196

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤100 m 67≤1 km 31≤10 km 58>10 km 1

157 georeferenced · 167 without coordinates

Open the institutions mapphysical evidence324

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	75
UMUlocation not on record	65
Helsinki, FI	64
Zürich, CH	16
Tartu, EE	9
DABUHlocation not on record	8
Muzeum Górnośląskie w Bytomiulocation not on record	7
ZSMlocation not on record	5
Provincia di Livornolocation not on record	5
Museu Nacional de História Natural e da Ciêncialocation not on record	3
Radicondoli, IT	3
UGRlocation not on record	1
NHMOlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1

14 institutions · 263 of 324 vouchered records shown · 61 without an institution code

09Environmental DNA51 detections

Where the DNA of Agrotis bigramma was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found51

Studies independent surveys1

Countries10

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 51 detections have coordinates

Open the map10 countries0

edge forestmeadowforest, mainly oakprivate garden

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.8 °C 15.4–21.4

Seasonal swing summer↔winter15.7 °C

Max temp (day)23.6 °C 18.7–25.3

Min temp (night)15.0 °C 11.3–18.4

Precipitation48.4 mm/mo 28.0–69.1

Air humidity57.5 % 51.7–61.9

Moisture balance-69.7 mm/mo -122–-24.2

Vapour deficit982 Pa 766–1,163

Wind speed3.10 m/s 2.10–6.50

Cloud cover34.8 % 22.7–38.5

CHELSA 1981–2010, ~9 km grid, at location & month of 49 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agrotis bigramma

At a glance

Sources9 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type5 199 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 199 records