Agromyza nana

Meigen, 1830 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Agromyzidae/Agromyza

At a glance

Occurrence records994

Data sources7

Biological traits0

DNA specimens47

eDNA detections81

Sources7 archives

Databases and archives Agromyza nana's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility994 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI81 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics47 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF994 records

Environmental DNA4 datasets · 8 countries81 detections

DNA & barcodingBOLD47 specimens

01Narrative

Agromyza nana is a species of fly in the family Agromyzidae. It is found in the Palearctic.Fauna EuropaeaBei-Bienko, G.Y. & Steyskal, G.C. (1988) Keys to the Insects of the European Part of the USSR, Volume V: Diptera and Siphonaptera, Parts I. II. Amerind Publishing Co., New Delhi. Description of imago-Interocular space red. Antennomeres 1 and II red. Peristoma and palps black. Dorsocentral bristles : 1 +3 subequal; acrostics in four rows. Legs black, knees red. Abdomen black with lighter pruinosity than the thorax. Long.:1,75-2,5 mm.Séguy, E. (1934) Diptères: Brachycères. II. Muscidae acalypterae, Scatophagidae. Paris: Éditions Faune de France 28 (FdeFr28)Dipt.Brachyceres.pdf Bibliothèque Virtuelle Numerique pdfSpencer, K. A. 1972 Diptera: Agromyzidae Handbooks for the Identification of British Insects Vol 10 Part 5g Royal Entomological Society, London pdf The larva mines Trifolium pratense, Melilotus altissima, Medicago.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding47 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agromyza nana has left across the world's sequence archives.

At a glance

DNA specimens47

BINs1

Marker genes1

eDNA detections81

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus46 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

84Gvariable

138Tmostly conserved

372Gvariable

630Amostly conserved

645Tmostly conserved

ACATTATACTTTATATTTGGAGCATGAGCTGGAATAGTCGGTACCTCTTTAAGTATCCTAATTCGAGCTGAATTAGGACACCCGGGGGCC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.34%

Haplotypes8

BIN1

Most divergent pair0.61%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agromyza frontellasame genus11.9%Phytomyza solidaginophagasame family12.5%Chlorops varsoviensissame order12.6%Phytomyza pubicornissame family12.7%Phytomyza flavicornissame family12.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type994 records

Wild obs. + sensor738

Museum / vouchered256

Range

Area of Occupancy AOO2 488 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 341≤1 km 136≤10 km 227>10 km 2

706 georeferenced · 32 without coordinates

Open the mapobservation + sensor738

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy81% within 1 km

≤100 m 46≤1 km 146≤10 km 45

237 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence256

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	178
Oulu, FI	46
South Kensington, GB	13
University of Tokyo, Department of Zoologylocation not on record	5
Naturalis Biodiversity Centerlocation not on record	1
NCMGlocation not on record	1
Norwegian Institute of Bioeconomy Researchlocation not on record	1

7 institutions · 245 of 256 vouchered records shown · 11 without an institution code

09Environmental DNA81 detections

Where the DNA of Agromyza nana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found81

Studies independent surveys4

Countries8

Verifiable raw sequence linked31

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 81 detections have coordinates

Open the map8 countries0

Garden and heatland, coastal habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.4 °C 10.7–17.0

Seasonal swing summer↔winter17.0 °C

Max temp (day)17.8 °C 14.2–20.7

Min temp (night)11.0 °C 7.50–14.0

Precipitation70.1 mm/mo 59.7–93.9

Air humidity61.0 % 58.4–64.4

Moisture balance-27.2 mm/mo -63.3–14.5

Vapour deficit638 Pa 478–760

Wind speed3.70 m/s 2.70–5.80

Cloud cover45.1 % 37.9–54.8

CHELSA 1981–2010, ~9 km grid, at location & month of 81 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)