Agromyza frontella

(Rondani, 1874) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Agromyzidae/Agromyza

At a glance

Occurrence records259

Data sources7

Biological traits0

DNA specimens128

eDNA detections341

Sources7 archives

Databases and archives Agromyza frontella's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility259 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI341 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics128 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF259 records

Environmental DNA4 datasets · 4 countries341 detections

DNA & barcodingBOLD128 specimens

01Narrative

Agromyza frontella, the alfalfa blotch leafminer, is a species of leaf miner flies in the family Agromyzidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding128 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agromyza frontella has left across the world's sequence archives.

At a glance

DNA specimens128

BINs1

Marker genes2

eDNA detections341

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P645 bp consensus125 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

342Tmostly conserved

432Gmostly conserved

ACATTATACTTTATATTTGGAGCTTGAGCCGGAATAGTAGGAACTTCTTTAAGTATTTTAATTCGAGCAGAATTAGGACACCCAGGTGCC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.21%

Haplotypes5

BIN1

Most divergent pair0.78%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Azelia nebulosasame order12.0%Phytomyza flavicornissame family12.2%Azelia cilipessame order12.3%Rachispoda vespertinasame order12.4%Liriomyza buhrisame family12.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S

animal barcoderibosomal

08Occurrence & distribution

Record type259 records

Wild obs. + sensor57

Museum / vouchered202

Range

Area of Occupancy AOO288 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy59% within 1 km

≤100 m 20≤1 km 9≤10 km 19>10 km 1

49 georeferenced · 8 without coordinates

Open the mapobservation + sensor57

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 4

5 georeferenced · 197 without coordinates

Open the institutions mapphysical evidence202

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	59
Biodiversity Institute of Ontariolocation not on record	40
South Kensington, GB	10
NHMOlocation not on record	4
Helsinki, FI	1

5 institutions · 114 of 202 vouchered records shown · 88 without an institution code

09Environmental DNA341 detections

Where the DNA of Agromyza frontella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found341

Studies independent surveys4

Countries4

Verifiable raw sequence linked213

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 341 detections have coordinates

Open the map4 countries0

14. Artificial - Terrestrial|14.1 Arable Landfarm4. Native GrasslandGrasslandWetlandMixed habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 8.70–17.2

Seasonal swing summer↔winter18.4 °C

Max temp (day)18.6 °C 12.1–21.8

Min temp (night)12.0 °C 7.20–15.6

Precipitation57.1 mm/mo 38.0–88.1

Air humidity60.5 % 55.1–61.6

Moisture balance-67.4 mm/mo -87.0–-37.7

Vapour deficit681 Pa 471–824

Wind speed4.00 m/s 3.30–5.30

Cloud cover41.3 % 39.6–46.0

CHELSA 1981–2010, ~9 km grid, at location & month of 338 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)