Agromyza filipendulae

Spencer, 1976 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Agromyzidae/Agromyza

At a glance

Occurrence records139

Data sources6

Biological traits0

DNA specimens12

eDNA detections205

Sources6 archives

Databases and archives Agromyza filipendulae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility139 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI205 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF139 records

Environmental DNA4 datasets · 6 countries205 detections

DNA & barcodingBOLD12 specimens

01Narrative

Agromyza filipendulae is een vliegensoort uit de familie van de mineervliegen (Agromyzidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1976 door Spencer.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agromyza filipendulae has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections205

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P620 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 24 variable positions, in barcode order

3Amostly conserved

4Tmostly conserved

5Tmostly conserved

6Amostly conserved

183Avariable

225Tvariable

252Amostly conserved

265Cvariable

318Cmostly conserved

321Tmostly conserved

366Tmostly conserved

390Cvariable

465Gvariable

547Tmostly conserved

556Cmostly conserved

567Tmostly conserved

612Cmostly conserved

613Gmostly conserved

614Amostly conserved

615Tmostly conserved

616Cmostly conserved

618Amostly conserved

619Gmostly conserved

620Cmostly conserved

ACATTATATTTTATATTTGGGGCTTGAGCAGGTATAGTAGGTACCTCATTAAGTATTCTAATTCGAGCAGAATTAGGACACCCAGGAGCC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes6

BIN1

Most divergent pair1.6%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agromyza luteitarsissame genus5.8%Agromyza albipennissame genus8.6%Agromyza nigrociliatasame genus10.0%Agromyza nigrellasame genus10.5%Cerodontha angulatasame family11.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type139 records

Wild obs. + sensor129

Museum / vouchered10

Range

Area of Occupancy AOO480 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 72≤1 km 25≤10 km 24

121 georeferenced · 8 without coordinates

Open the mapobservation + sensor129

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤1 km 4≤10 km 1>10 km 1

6 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Oulu, FI	5
University of Oslo, Natural History Museumlocation not on record	3
University of Tokyo, Department of Zoologylocation not on record	1

3 institutions · 9 of 10 vouchered records shown · 1 without an institution code

09Environmental DNA205 detections

Where the DNA of Agromyza filipendulae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found205

Studies independent surveys4

Countries6

Verifiable raw sequence linked168

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 205 detections have coordinates

Open the map6 countries0

vineyard

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 12.5–16.8

Seasonal swing summer↔winter17.1 °C

Max temp (day)17.9 °C 15.6–20.2

Min temp (night)11.2 °C 8.10–13.7

Precipitation67.9 mm/mo 59.3–112

Air humidity62.8 % 58.5–64.4

Moisture balance-10.0 mm/mo -54.4–22.0

Vapour deficit644 Pa 521–724

Wind speed4.10 m/s 2.70–4.70

Cloud cover45.1 % 40.6–53.0

CHELSA 1981–2010, ~9 km grid, at location & month of 205 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)