Agromyza nigrociliata

Hendel, 1931 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Agromyzidae/Agromyza

At a glance

Occurrence records122

Data sources6

Biological traits0

DNA specimens22

eDNA detections16

Sources6 archives

Databases and archives Agromyza nigrociliata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility122 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF122 records

Environmental DNA2 datasets · 6 countries16 detections

DNA & barcodingBOLD22 specimens

01Narrative

Agromyza nigrociliata is een vliegensoort uit de familie van de mineervliegen (Agromyzidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1931 door Hendel.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agromyza nigrociliata has left across the world's sequence archives.

At a glance

DNA specimens22

BINs4

Marker genes1

eDNA detections16

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 30 variable positions, in barcode order

12Tmostly conserved

27Gmostly conserved

84Avariable

196Tvariable

198Avariable

201Tmostly conserved

225Cvariable

267Avariable

288Cvariable

294Gmostly conserved

303Avariable

312Tmostly conserved

315Avariable

327Avariable

333Cmostly conserved

363Cvariable

372Amostly conserved

381Cvariable

477Amostly conserved

495Avariable

507Amostly conserved

540Gmostly conserved

541Cvariable

543Amostly conserved

549Amostly conserved

591Amostly conserved

615Tmostly conserved

618Tmostly conserved

633Cvariable

645Tmostly conserved

ACATTATATTTTATATTTGGAGCCTGGGCAGGCATGGTAGGTACTTCCTTAAGTATTTTAATTCGAGCTGAACTAGGACATCCAGGAGCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.9%

Haplotypes6

BINs4

Most divergent pair3.7%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agromyza mobilissame genus6.6%Agromyza luteitarsissame genus8.1%Agromyza ambiguasame genus9.0%Agromyza bromisame genus9.1%Agromyza nigrellasame genus9.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type122 records

Wild obs. + sensor97

Museum / vouchered25

Range

Area of Occupancy AOO272 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy53% within 1 km

≤100 m 33≤1 km 17≤10 km 43>10 km 1

94 georeferenced · 3 without coordinates

Open the mapobservation + sensor97

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 1≤1 km 5>10 km 1

7 georeferenced · 18 without coordinates

Open the institutions mapphysical evidence25

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	6
South Kensington, GB	6
NHMOlocation not on record	3
Stockholm, SE	1
European Distributed Institute of Taxonomy (EDIT)location not on record	1
Wellcome Sanger Institutelocation not on record	1
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	1
NCMGlocation not on record	1
V. N. Karazin Kharkiv National Universitylocation not on record	1

9 institutions · 21 of 25 vouchered records shown · 4 without an institution code

09Environmental DNA16 detections

Where the DNA of Agromyza nigrociliata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys2

Countries6

Verifiable raw sequence linked4

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map6 countries0

ForestMixed habitatFarmland, coast and birch habitatRiparian Zone

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.5 °C 9.60–15.2

Seasonal swing summer↔winter24.8 °C

Max temp (day)16.5 °C 12.7–19.0

Min temp (night)7.00 °C 4.90–11.6

Precipitation58.8 mm/mo 47.5–105

Air humidity56.1 % 55.2–61.0

Moisture balance-47.6 mm/mo -66.5–-10.0

Vapour deficit600 Pa 488–752

Wind speed3.40 m/s 2.50–4.80

Cloud cover40.6 % 36.6–49.3

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)