Agroeca pratensis

Emerton, 1890 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Liocranidae/Agroeca

At a glance

Occurrence records206

Data sources8

Biological traits3

DNA specimens23

eDNA detections24

Sources8 archives

Databases and archives Agroeca pratensis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility206 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

World Spider Trait DBMasaryk University3 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF206 records

Environmental DNA1 datasets · 2 countries24 detections

DNA & barcodingBOLD23 specimens

01Narrative

Agroeca pratensis is a species of liocranid sac spider in the family Liocranidae. It is found in the United States and Canada.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesDondale & Redner 1982

Morphometry3

Body length♀6.3·♂5.05 mm

Cephalothorax length♀2.63·♂2.41 mm

Cephalothorax width♀1.94·♂1.85 mm

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agroeca pratensis has left across the world's sequence archives.

At a glance

DNA specimens23

BINs1

Marker genes1

eDNA detections24

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

64Amostly conserved

193Gmostly conserved

262Amostly conserved

277Gmostly conserved

625Amostly conserved

628Gmostly conserved

634Amostly conserved

638Tmostly conserved

TTTATATTTAATATTTGGGGCTTGAGCTGCTATAGTTGGTACTGCAATAAGTGTTTTAATTCGAATGGAGTTAGGGCAATCTGGTAGATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.9%

Haplotypes7

BIN1

Most divergent pair17.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agroeca brunneasame genus4.9%Agroeca lusaticasame genus5.5%Agroeca dentigerasame genus5.8%Agroeca cupreasame genus8.9%Agroeca proximasame genus8.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type206 records

Wild obs. + sensor5

Museum / vouchered201

Range

Area of Occupancy AOO292 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 3>10 km 1

4 georeferenced · 1 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤100 m 3≤1 km 5≤10 km 52>10 km 1

61 georeferenced · 140 without coordinates

Open the institutions mapphysical evidence201

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	85
Denver, US	42
Chicago, US	34
Ohio State University Acarology Laboratorylocation not on record	13
WIlocation not on record	7
Vancouver, CA	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
Champaign, US	2
Cincinnati, US	1
San Francisco, US	1
Royal Saskatchewan Museumlocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
Saint John, CA	1

13 institutions · 192 of 201 vouchered records shown · 9 without an institution code

09Environmental DNA24 detections

Where the DNA of Agroeca pratensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map2 countries0

ForestGrasslandMixed HabitatWetland4. Native Grassland | 4.4. Temperate Grassland1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 7.70–21.2

Seasonal swing summer↔winter25.5 °C

Max temp (day)22.0 °C 11.5–28.7

Min temp (night)10.0 °C 4.10–16.1

Precipitation82.7 mm/mo 28.1–114

Air humidity55.6 % 45.0–62.3

Moisture balance-47.7 mm/mo -145–33.0

Vapour deficit814 Pa 416–1,282

Wind speed2.80 m/s 2.20–4.70

Cloud cover39.1 % 29.5–53.8

CHELSA 1981–2010, ~9 km grid, at location & month of 24 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)