Agroeca cuprea

Menge, 1873 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Liocranidae/Agroeca

At a glance

Occurrence records3 203

Data sources7

Biological traits12

DNA specimens16

eDNA detections10

Sources7 archives

Databases and archives Agroeca cuprea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 203 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

World Spider Trait DBMasaryk University12 traits · 26 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements26 literature sources12 traits

Occurrence & distributionGBIF3 203 records

Environmental DNA1 datasets · 2 countries10 detections

DNA & barcodingBOLD16 specimens

01Narrative

Agroeca cuprea est une espèce d'araignées aranéomorphes de la famille des Liocranidae.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 26 sources

Entling et al. 2007Buchar & Růžička 2002Wolff et al. 2013SLU 2020Harvey et al. 2017Gajdoš et al. 2014Liste France 2018Henriksen & Hilmo 2015Staręga et al. 2001Hyvärinen et al. 2019Komposch & Steinberger 1999Maelfait et al. 1998Řezáč et al. 2015Noflatscher 1994Blick et al. 2016Blick & Scheidler 2004Kielhorn 2017Finch 2004Martin 2012Buchholz et al. 2011Hiebsch & Tolke 1996Sacher & Platen 2004Lemke et al. 2013Nährig et al. 2003Nentwig et al. 2018Cardoso et al. 2011

Morphometry2

Body length♀4.47·♂3.75 mm

Claw tuft area0 mm

Predation2

Hunting guildground hunters

Web buildingno

Ecology8

Light0.75 mm

Light 2partly shaded

Microhabitatsand, litter

Moisture 10.125 mm

Moisture 2dry

Regional IUCN Red List categoryLeast Concern (LC)

Regional non-IUCN Red List categoryNear Threatened (V)

Stratumground

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agroeca cuprea has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes1

eDNA detections10

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

28Gmostly conserved

79Gmostly conserved

109Tmostly conserved

166Gmostly conserved

181Cmostly conserved

368Gmostly conserved

403Gmostly conserved

412Amostly conserved

436Tmostly conserved

535Gmostly conserved

562Gmostly conserved

568Amostly conserved

AACTTTGTATTTAATTTTTGGGGCTTGGGCTGCTATAGTGGGTACTGCAATAAGAGTTTTAATTCGTATAGAGTTGGGGCAATCTGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.51%

Haplotypes3

BIN1

Most divergent pair1.4%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agroeca proximasame genus8.8%Agroeca pratensissame genus8.9%Agroeca lusaticasame genus9.6%Agroeca brunneasame genus9.6%Agroeca dentigerasame genus10.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 203 records

Wild obs. + sensor1 960

Museum / vouchered1 210

Other33

Origin

Native300

Range

Area of Occupancy AOO2 112 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy10% within 1 km

≤100 m 91≤1 km 92≤10 km 1 558>10 km 18

1 759 georeferenced · 201 without coordinates

Open the mapobservation + sensor1 960

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 22≤1 km 45≤10 km 142>10 km 7

216 georeferenced · 994 without coordinates

Open the institutions mapphysical evidence1 210

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	824
Adam Mickiewicz University in Poznańlocation not on record	104
Brussels, BE	88
Provincia di Livornolocation not on record	35
Paro, BT	22
Frankfurt am Main	16
Musee d'Histoire Naturallelocation not on record	16
Ekaterinburg, RU	13
Institute of Plant and Animal Ecology (IPAE), UB RASlocation not on record	11
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	10
Uniwersytet w Białymstokulocation not on record	8
Akademia Pomorska w Słupskulocation not on record	6
SLU Artdatabankenlocation not on record	6
Geneva, CH	4
University of Lodz, Department of Invertebrate Zoology and Hydrobiologylocation not on record	4
Prioksko-Terrasnyi Biosphere Reservelocation not on record	3
ZSMlocation not on record	2
EIBElocation not on record	2
Bavarian State Collection of Zoologylocation not on record	2
Tartu, EE	2
Bonn, DE	2
European Distributed Institute of Taxonomy (EDIT)location not on record	2
SNSB-Zoologische Staatssammlung Münchenlocation not on record	2
University of Tokyo, Department of Zoologylocation not on record	1
	1
Centre for Biodiversity Genomicslocation not on record	1

26 institutions · 1 187 of 1 210 vouchered records shown · 22 without an institution code

09Environmental DNA10 detections

Where the DNA of Agroeca cuprea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map2 countries0

yard

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.7 °C 12.9–21.0

Seasonal swing summer↔winter22.5 °C

Max temp (day)22.2 °C 17.2–24.2

Min temp (night)11.2 °C 7.90–17.2

Precipitation54.7 mm/mo 50.3–75.9

Air humidity57.3 % 56.8–60.8

Moisture balance-65.2 mm/mo -88.1–-17.9

Vapour deficit882 Pa 592–1,069

Wind speed3.30 m/s 1.60–3.40

Cloud cover40.7 % 39.2–42.4

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agroeca cuprea

At a glance

Sources7 archives

Morphometry2

Predation2

Ecology8

At a glance

Record type3 203 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 26 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 203 records