Agriphila selasella

Hübner · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Agriphila

At a glance

Occurrence records11 774

Data sources7

Biological traits0

DNA specimens19

eDNA detections1

Sources7 archives

Databases and archives Agriphila selasella's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility11 774 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF11 774 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD19 specimens

Genome at a glanceGoaT≈682 Mbp

01Narrative

Agriphila selasella is a species of moth of the family Crambidae. It was described by Jacob Hübner in 1813 and is found in Europe and east across the Palearctic. Fig.9 larva after final moult The wingspan is about 26 mm. The face is slightly prominent. Forewings are whitish-ochreous or ochreous, mixed or sometimes much suffused with light fuscous; a moderately thick well-defined white median streak from base to 3/4 or 5/6 terminating in two or three fine whitish streaks on veins ; sometimes some indistinct blackish terminal dots ; cilia shining fuscous. Hindwings are grey.The larva is brown, paler laterally ; spots large, dark brown ; head black ; plate of 2 black -brown.Meyrick, E., 1895 A Handbook of British Lepidoptera MacMillan, London pdf Keys and description The moth flies from July to August depending on the location. The larvae feed on various grasses, such as Puccinellia maritima and Festuca ovina.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agriphila selasella has left across the world's sequence archives.

At a glance

DNA specimens19

BINs1

Marker genes1

eDNA detections1

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

199Gvariable

200Gmostly conserved

223Tmostly conserved

433Gmostly conserved

454Avariable

478Gmostly conserved

479Tmostly conserved

542Tmostly conserved

622Amostly conserved

628Gmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTGGGAACATCTTTAAGATTATTAATTCGTGCTGAATTAGGAAATCCCGGTTG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.37%

Haplotypes10

BIN1

Most divergent pair0.76%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agriphila deliellasame genus6.4%Agriphila tollisame genus7.4%Agriphila geniculeasame genus7.4%Agriphila latistriasame genus7.4%Agriphila dalmatinellussame genus7.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Agriphila selasella carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈682 177 140 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Agriphila selasella0.68 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.8% BUSCO

08Occurrence & distribution

Record type11 774 records

Wild obs. + sensor10 571

Museum / vouchered1 154

Other49

Range

Area of Occupancy AOO14 508 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 5 062≤1 km 1 916≤10 km 3 090>10 km 26

10 094 georeferenced · 477 without coordinates

Open the mapobservation + sensor10 571

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 322≤1 km 241≤10 km 271>10 km 204

1 038 georeferenced · 116 without coordinates

Open the institutions mapphysical evidence1 154

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	457
DanishLepidopterologicalSocietylocation not on record	182
NHMOlocation not on record	67
Tartu, EE	51
Kuopio, FI	36
NTNU-VMlocation not on record	33
Zürich, CH	29
Adam Mickiewicz University in Poznańlocation not on record	24
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	23
Provincia di Livornolocation not on record	19
SLU Artdatabankenlocation not on record	19
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	18
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	16
Natural History Museum Rotterdamlocation not on record	12
Philadelphia, US	11
Nijmegen, NL	6
Uniwersytet Łódzkilocation not on record	3
Metsähallituslocation not on record	3
South Kensington, GB	3
University of Kaiserslauternlocation not on record	3
neflocation not on record	2
ZMAAlocation not on record	2
NMBU:MINAlocation not on record	2
Stockholm, SE	2
MZLUlocation not on record	2
ZSMlocation not on record	1
Banyoles, ES	1
Durban Natural Science Museumlocation not on record	1
NTNU University Museum, Department of Natural Historylocation not on record	1
Natural History Museum, Londonlocation not on record	1
Trondheim, NO	1
Salzburg, AT	1
CBDClocation not on record	1

33 institutions · 1 033 of 1 154 vouchered records shown · 121 without an institution code

09Environmental DNA1 detections

Where the DNA of Agriphila selasella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 15.7–15.7

Seasonal swing summer↔winter14.9 °C

Max temp (day)18.1 °C

Min temp (night)12.7 °C

Precipitation127 mm/mo

Air humidity62.5 %

Moisture balance32.3 mm/mo

Vapour deficit673 Pa

Wind speed2.60 m/s

Cloud cover44.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agriphila selasella

At a glance

Sources7 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type11 774 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 33 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type11 774 records