Agriphila attenuatus

Grote, 1880 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Agriphila

At a glance

Occurrence records194

Data sources6

Biological traits0

DNA specimens16

eDNA detections17

Sources6 archives

Databases and archives Agriphila attenuatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility194 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF194 records

Environmental DNA1 datasets · 1 countries17 detections

DNA & barcodingBOLD16 specimens

01Narrative

Agriphila attenuatus is een vlinder uit de familie van de grasmotten (Crambidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1880 door Grote.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agriphila attenuatus has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes1

eDNA detections17

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 86% of positions are identical in every specimen.

Where individuals differ — all 90 variable positions, in barcode order

9Amostly conserved

11Tmostly conserved

13Tmostly conserved

14Amostly conserved

17Tmostly conserved

18Tmostly conserved

19Tmostly conserved

20Gmostly conserved

21Gmostly conserved

22Avariable

23Amostly conserved

24Tmostly conserved

25Tmostly conserved

26Tmostly conserved

27Gmostly conserved

28Amostly conserved

30Cmostly conserved

32Gmostly conserved

33Gmostly conserved

34Tmostly conserved

35Amostly conserved

39Tmostly conserved

40Amostly conserved

41Gmostly conserved

42Gmostly conserved

43Amostly conserved

44Amostly conserved

46Tmostly conserved

47Tmostly conserved

48Cmostly conserved

49Cmostly conserved

50Cmostly conserved

51Tmostly conserved

53Amostly conserved

54Gmostly conserved

56Tmostly conserved

61Amostly conserved

62Amostly conserved

63Tmostly conserved

65Cmostly conserved

66Gmostly conserved

69Cmostly conserved

70Tmostly conserved

71Gmostly conserved

72Amostly conserved

74Tmostly conserved

75Tmostly conserved

77Gmostly conserved

78Gmostly conserved

79Amostly conserved

80Amostly conserved

81Amostly conserved

83Cmostly conserved

84Cmostly conserved

85Tmostly conserved

86Gmostly conserved

87Gmostly conserved

88Cmostly conserved

89Tmostly conserved

90Cmostly conserved

92Cmostly conserved

95Amostly conserved

96Tmostly conserved

97Tmostly conserved

99Gmostly conserved

100Amostly conserved

197Cmostly conserved

214Amostly conserved

247Tvariable

277Cvariable

287Cvariable

304Tmostly conserved

313Cvariable

364Tmostly conserved

386Cmostly conserved

397Tmostly conserved

400Avariable

421Tvariable

466Amostly conserved

477Gmostly conserved

478Avariable

514Tmostly conserved

522Tmostly conserved

523Cvariable

550Amostly conserved

557Tvariable

583Tmostly conserved

610Cmostly conserved

622Amostly conserved

646Tmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCTGGTATAGTAGGAACTTCCCTAAGATTAATAATTCGTGCTGAATTAGGAAATCCTGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.6%

Haplotypes6

BIN1

Most divergent pair2.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agriphila tollisame genus5.9%Agriphila geniculeasame genus6.2%Agriphila dalmatinellussame genus6.4%Agriphila latistriasame genus6.4%Agriphila argentistrigellussame genus6.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type194 records

Wild obs. + sensor35

Museum / vouchered159

Range

Area of Occupancy AOO236 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 16≤1 km 3≤10 km 14

33 georeferenced · 2 without coordinates

Open the mapobservation + sensor35

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 18≤1 km 25≤10 km 35

78 georeferenced · 81 without coordinates

Open the institutions mapphysical evidence159

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Diego, US	34
Santa Barbara Museum of Natural Historylocation not on record	27
University of Alberta Museums (UAM)location not on record	24
San Francisco, US	19
New Haven, US	17
ASUlocation not on record	14
Santa Cruz, US	11
Oregon State Arthropod Collectionlocation not on record	4
Mississippi State, US	3
Essig Museum of Entomologylocation not on record	2
Vernal, US	2
Awka, NG	2

12 institutions · 159 of 159 vouchered records shown

09Environmental DNA17 detections

Where the DNA of Agriphila attenuatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map1 country0

Coastal Sage Scrub

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.4 °C 15.0–18.4

Seasonal swing summer↔winter14.5 °C

Max temp (day)24.6 °C 20.5–26.0

Min temp (night)11.2 °C 9.50–13.1

Precipitation23.4 mm/mo 17.5–80.2

Air humidity51.9 % 44.3–64.7

Moisture balance-63.5 mm/mo -89.2–-14.7

Vapour deficit955 Pa 599–1,129

Wind speed1.70 m/s 1.70–4.00

Cloud cover28.6 % 20.1–34.6

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)