Agriotes gallicus

Lacordaire, 1835 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Elateridae/Agriotes

At a glance

Occurrence records1 183

Data sources6

Biological traits0

DNA specimens10

eDNA detections10

Sources6 archives

Databases and archives Agriotes gallicus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 183 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 183 records

Environmental DNA1 datasets · 1 countries10 detections

DNA & barcodingBOLD10 specimens

01Narrative

Agriotes gallicus is een keversoort uit de familie kniptorren (Elateridae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1835 door Lacordaire.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agriotes gallicus has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections10

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.09%

Haplotypes1

BIN1

Where individuals differ — all 2 variable positions, in barcode order

133Cmostly conserved

460Cmostly conserved

AACCCTATACTTCCTTTTCGGCGCTTGGGCCGGAATACTAGGAACATCCCTTAGACTACTAATTCGTGCTGAACTAGGTAACCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agriotes ustulatussame genus10.9%Dalopius cognatussame family12.7%Agriotes opaculussame genus12.8%Agriotes acutussame genus12.9%Agriotes mancussame genus13.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 183 records

Wild obs. + sensor604

Museum / vouchered567

Cultivated / captive2

Other10

Origin

Native320

Range

Area of Occupancy AOO1 876 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy32% within 1 km

≤100 m 81≤1 km 93≤10 km 360>10 km 5

539 georeferenced · 65 without coordinates

Open the mapobservation + sensor604

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy5% within 1 km

≤1 km 27≤10 km 518>10 km 3

548 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence567

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Geneva, CH	83
Zürich, CH	55
Bern, CH	35
Natural History Museum Rotterdamlocation not on record	15
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	13
Winterthur, CH	11
Fribourg, CH	10
Muséum d'histoire naturelle de Lillelocation not on record	10
Paro, BT	9
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	6
Museum zu Allerheiligen Schaffhausenlocation not on record	6
Uniwersytet Wrocławskilocation not on record	5
Musee d'Histoire Naturallelocation not on record	4
MUZOO - Musée d'histoire naturelle de La Chaux-de-Fondslocation not on record	4
Frauenfeld, CH	4
MUGRlocation not on record	2
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	2
MSNMlocation not on record	2
Naturama Aargaulocation not on record	2
Ugentlocation not on record	2
Provincia di Livornolocation not on record	1
Salzburg, AT	1
ZSMlocation not on record	1
Tilburg, NL	1

24 institutions · 284 of 567 vouchered records shown · 283 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA10 detections

Where the DNA of Agriotes gallicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map1 country0

TrockenrasenStreuobstwiese

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.4 °C 1.20–18.5

Seasonal swing summer↔winter17.7 °C

Max temp (day)19.5 °C 3.70–22.8

Min temp (night)10.9 °C -1.40–14.2

Precipitation64.4 mm/mo 45.2–72.8

Air humidity60.4 % 58.4–66.7

Moisture balance-42.9 mm/mo -65.8–25.7

Vapour deficit701 Pa 227–892

Wind speed3.20 m/s 2.80–3.70

Cloud cover33.3 % 29.9–52.1

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agriotes gallicus

At a glance

Sources6 archives

At a glance

Record type1 183 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions9 of 24 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 183 records