Agrilus putillus

Say, 1833 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Agrilus

At a glance

Occurrence records44

Data sources8

Biological traits0

DNA specimens11

eDNA detections11

Sources8 archives

Databases and archives Agrilus putillus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility44 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF44 records

Environmental DNA1 datasets · 1 countries11 detections

DNA & barcodingBOLD11 specimens

01Narrative

Agrilus putillus is a species of metallic wood-boring beetle in the family Buprestidae. It is found in Canada,North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrilus putillus has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections11

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P622 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Diversity (π)2.9%

Haplotypes1

BIN1

Where individuals differ — all 64 variable positions, in barcode order

1Gmostly conserved

2Amostly conserved

3Cmostly conserved

5Cmostly conserved

6Tmostly conserved

7Amostly conserved

9Amostly conserved

10Cmostly conserved

11Tmostly conserved

13Tmostly conserved

14Amostly conserved

17Tmostly conserved

18Tmostly conserved

19Cmostly conserved

21Gmostly conserved

22Amostly conserved

23Gmostly conserved

24Cmostly conserved

25Tmostly conserved

26Tmostly conserved

27Gmostly conserved

28Gmostly conserved

30Cmostly conserved

31Cmostly conserved

32Gmostly conserved

33Gmostly conserved

35Amostly conserved

37Amostly conserved

39Tmostly conserved

40Gmostly conserved

41Gmostly conserved

42Gmostly conserved

43Amostly conserved

44Amostly conserved

46Gmostly conserved

47Gmostly conserved

48Cmostly conserved

49Cmostly conserved

50Cmostly conserved

51Tmostly conserved

52Tmostly conserved

53Amostly conserved

54Gmostly conserved

55Amostly conserved

56Cmostly conserved

58Tmostly conserved

59Tmostly conserved

61Amostly conserved

62Amostly conserved

63Tmostly conserved

64Cmostly conserved

65Cmostly conserved

66Gmostly conserved

67Gmostly conserved

69Cmostly conserved

71Gmostly conserved

72Amostly conserved

74Tmostly conserved

75Tmostly conserved

220Amostly conserved

274Amostly conserved

319Gmostly conserved

362Amostly conserved

466Amostly conserved

GACACTATACTTTATCTTCGGAGCTTGGGCCGGAATAGTGGGAACGGCCCTTAGACTTTTAATCCGGGCAGAATTAGGAAACCCAGGTGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrilus kurumisame genus16.6%Agrilus blatteicollissame genus17.4%Agrilus roscidussame genus17.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type44 records

Wild obs. + sensor1

Museum / vouchered43

Range

Area of Occupancy AOO68 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 43 records without

Open the institutions mapphysical evidence43

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Agency of Natural Resources Department of Forests, Parks and Recreationlocation not on record	26
SOVTlocation not on record	12
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
Washington, US	1

4 institutions · 41 of 43 vouchered records shown · 2 without an institution code

09Environmental DNA11 detections

Where the DNA of Agrilus putillus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map1 country0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.6 °C 19.1–21.1

Seasonal swing summer↔winter26.4 °C

Max temp (day)25.4 °C 23.8–25.9

Min temp (night)16.1 °C 15.0–17.8

Precipitation92.5 mm/mo 80.0–98.5

Air humidity57.8 % 57.3–59.4

Moisture balance-59.8 mm/mo -68.3–-34.9

Vapour deficit1,029 Pa 919–1,041

Wind speed3.10 m/s 2.60–3.50

Cloud cover39.7 % 39.3–42.4

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)