Agrilus pratensis

(Ratzeburg, 1837) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Agrilus

At a glance

Occurrence records973

Data sources8

Biological traits0

DNA specimens10

eDNA detections11

Sources8 archives

Databases and archives Agrilus pratensis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility973 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF973 records

Environmental DNA2 datasets · 6 countries11 detections

DNA & barcodingBOLD10 specimens

01Narrative

Abb. 1: Seitenansicht Der Rotblaue Pappel-Prachtkäfer (Agrilus pratensis) ist ein Käfer aus der Familie der Prachtkäfer und der Unterfamilie der Agrilinae. Der Käfer gehört zu der großen Gattung Agrilus, die in Europa durch über siebzig größtenteils schwer zu unterscheidende Arten vertreten ist. Der Artname pratensis (auf der Wiese lebend von lat. prātum: Wiese) ist irreführend, da der Käfer überwiegend auf Pappeln anzutreffen ist. Die Farbkombination rot-blau, die im deutschen Namen enthalten ist, ist nur bei einem Teil der Individuen zu beobachten.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrilus pratensis has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes2

eDNA detections11

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P638 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

73Gmostly conserved

76Gmostly conserved

79Gmostly conserved

97Tmostly conserved

130Amostly conserved

205Amostly conserved

362Gmostly conserved

412Cmostly conserved

490Cvariable

AACCCTTTACTTTATCTTTGGGGCTTGGTCAGGAATGGTTGGAACAGCGCTTAGATTACTAATTCGAGCAGAGTTGGGGAATCCTGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.46%

Haplotypes3

BIN1

Most divergent pair0.63%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrilus vorisekisame genus13.0%Agrilus delphinensissame genus15.7%Chrysobothris malisame family15.7%Korynetes caeruleussame order16.8%Ptomaphagus mediussame order17.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type973 records

Wild obs. + sensor435

Museum / vouchered501

Other37

Origin

Native154

Range

Area of Occupancy AOO2 348 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy48% within 1 km

≤100 m 108≤1 km 80≤10 km 194>10 km 9

391 georeferenced · 44 without coordinates

Open the mapobservation + sensor435

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 40≤1 km 83≤10 km 331>10 km 5

459 georeferenced · 42 without coordinates

Open the institutions mapphysical evidence501

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	70
Brussels, BE	40
Geneva, CH	32
Musee d'Histoire Naturallelocation not on record	30
Fribourg, CH	26
Bern, CH	25
IFR-DNFlocation not on record	24
Muzeum Górnośląskie w Bytomiulocation not on record	15
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	15
Paro, BT	14
Zürich, CH	14
Provincia di Livornolocation not on record	14
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	10
Uniwersytet Wrocławskilocation not on record	10
Helsinki, FI	9
Salzburg, AT	5
RBINS-Scientific Heritagelocation not on record	5
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	4
Natural History Museum Rotterdamlocation not on record	4
MZLUlocation not on record	4
Tartu, EE	3
Trondheim, NO	3
NMPClocation not on record	2
Musée de l'Hospice du Grand-Saint-Bernardlocation not on record	2
Winterthur, CH	2
NTNU-VMlocation not on record	2
Naturmuseum Solothurnlocation not on record	2
Frauenfeld, CH	2
BioFokuslocation not on record	1
Ugentlocation not on record	1
Tilburg, NL	1

31 institutions · 391 of 501 vouchered records shown · 110 without an institution code

09Environmental DNA11 detections

Where the DNA of Agrilus pratensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys2

Countries6

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.4 °C 5.90–15.7

Seasonal swing summer↔winter20.5 °C

Max temp (day)16.8 °C 9.70–20.1

Min temp (night)6.70 °C 1.10–10.9

Precipitation77.1 mm/mo 68.5–84.4

Air humidity58.9 % 57.4–65.9

Moisture balance-23.9 mm/mo -53.1–28.8

Vapour deficit598 Pa 370–762

Wind speed2.50 m/s 1.80–3.50

Cloud cover41.6 % 35.5–43.9

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)