Agrilus delphinensis

Abeille de Perrin, 1897 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Agrilus

At a glance

Occurrence records38

Data sources7

Biological traits0

DNA specimens6

eDNA detections5

Sources7 archives

Databases and archives Agrilus delphinensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility38 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF38 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD6 specimens

01Narrative

Agrilus delphinensis é uma espécie de inseto do género Agrilus, família Buprestidae, ordem Coleoptera. Foi descrita cientificamente por Abeille de Perrin, 1897.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrilus delphinensis has left across the world's sequence archives.

At a glance

DNA specimens6

BINs2

Marker genes2

eDNA detections5

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 83% of positions are identical in every specimen.

Diversity (π)8.9%

Haplotypes2

BINs2

Most divergent pair0.77%

Where individuals differ — all 114 variable positions, in barcode order

36Amostly conserved

39Cmostly conserved

42Gmostly conserved

48Cmostly conserved

51Amostly conserved

57Gmostly conserved

60Amostly conserved

63Amostly conserved

64Cmostly conserved

66Tmostly conserved

70Cmostly conserved

72Amostly conserved

73Cmostly conserved

93Gmostly conserved

96Tmostly conserved

99Tmostly conserved

102Cmostly conserved

135Amostly conserved

150Cmostly conserved

153Tmostly conserved

157Gmostly conserved

168Cmostly conserved

177Tmostly conserved

180Amostly conserved

186Cmostly conserved

195Gmostly conserved

198Amostly conserved

204Avariable

207Cmostly conserved

211Tmostly conserved

226Cmostly conserved

228Tmostly conserved

246Amostly conserved

252Cvariable

261Cmostly conserved

264Cmostly conserved

279Cmostly conserved

285Tmostly conserved

288Amostly conserved

297Gvariable

300Amostly conserved

304Cmostly conserved

306Gmostly conserved

309Amostly conserved

316Gmostly conserved

321Tmostly conserved

330Gmostly conserved

336Gmostly conserved

342Gmostly conserved

348Tmostly conserved

351Cmostly conserved

357Cmostly conserved

361Cmostly conserved

363Tmostly conserved

366Cmostly conserved

367Tmostly conserved

369Tmostly conserved

378Cmostly conserved

381Tmostly conserved

387Gmostly conserved

390Amostly conserved

402Gmostly conserved

405Tmostly conserved

414Gmostly conserved

417Tmostly conserved

420Cmostly conserved

421Tmostly conserved

423Amostly conserved

426Amostly conserved

432Cmostly conserved

435Cmostly conserved

438Cmostly conserved

441Cmostly conserved

442Tmostly conserved

444Amostly conserved

450Tmostly conserved

456Cmostly conserved

465Amostly conserved

477Cvariable

483Gmostly conserved

484Tmostly conserved

487Cmostly conserved

489Gmostly conserved

498Tmostly conserved

501Amostly conserved

504Tmostly conserved

513Tmostly conserved

514Tmostly conserved

516Amostly conserved

532Gmostly conserved

534Tmostly conserved

543Cmostly conserved

544Cmostly conserved

546Cmostly conserved

547Cmostly conserved

550Cmostly conserved

552Tmostly conserved

556Cmostly conserved

561Cmostly conserved

570Tmostly conserved

579Amostly conserved

595Cmostly conserved

597Cmostly conserved

603Cmostly conserved

615Cmostly conserved

618Cmostly conserved

621Cmostly conserved

624Cmostly conserved

627Cmostly conserved

633Amostly conserved

636Amostly conserved

642Avariable

645Amostly conserved

648Cmostly conserved

CATAAAGACATTGGAACTCTGTATTTTATTTTTGGAGCCTGGTCAGGCATAGTAGGGACAGCACTTAGACTACTAATTCGAGCAGAGTTA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrilus vorisekisame genus15.0%Agrilus pratensissame genus15.7%Agrilus sibiricussame genus16.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type38 records

Wild obs. + sensor9

Museum / vouchered29

Range

Area of Occupancy AOO112 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced · 7 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤1 km 3≤10 km 5

8 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence29

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	10
EJCBlocation not on record	5
IFR-DNFlocation not on record	4
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	1
Zoological Institute, Russian Academy of Scienceslocation not on record	1
NSMKlocation not on record	1
Natural History Museum Rotterdamlocation not on record	1
Muzeum Górnośląskie w Bytomiulocation not on record	1

8 institutions · 24 of 29 vouchered records shown · 3 without an institution code

09Environmental DNA5 detections

Where the DNA of Agrilus delphinensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.90 °C 5.90–12.7

Seasonal swing summer↔winter20.5 °C

Max temp (day)9.70 °C 9.70–16.7

Min temp (night)1.10 °C 1.10–8.10

Precipitation82.6 mm/mo 65.2–82.6

Air humidity65.9 % 60.6–65.9

Moisture balance28.8 mm/mo -33.2–28.8

Vapour deficit370 Pa 370–657

Wind speed1.80 m/s 1.80–3.10

Cloud cover43.4 % 39.8–43.4

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)