Agrilus obsoletoguttatus

Gory, 1841 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Agrilus

At a glance

Occurrence records368

Data sources8

Biological traits0

DNA specimens15

eDNA detections11

Sources8 archives

Databases and archives Agrilus obsoletoguttatus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility368 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF368 records

Environmental DNA1 datasets · 1 countries11 detections

DNA & barcodingBOLD15 specimens

01Narrative

Agrilus obsoletoguttatus is a species of metallic wood-boring beetle in the family Buprestidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrilus obsoletoguttatus has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes2

eDNA detections11

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

100Gmostly conserved

154Cmostly conserved

181Gmostly conserved

463Cmostly conserved

625Amostly conserved

646Cmostly conserved

AACGCTTTACTTTATTTTTGGGGCATGATCGGGGATAGTAGGAACAGCTTTAAGATTACTAATCCGGGCCGAGCTGGGAAACCCAGGGGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.23%

Haplotypes5

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthaxomorphus papuanussame family16.3%Agrilus planipennissame genus16.3%Agrilus sospessame genus16.3%Agrilus sibiricussame genus16.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type368 records

Wild obs. + sensor208

Museum / vouchered160

Range

Area of Occupancy AOO1 064 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 99≤1 km 41≤10 km 12>10 km 22

174 georeferenced · 34 without coordinates

Open the mapobservation + sensor208

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤1 km 6≤10 km 11>10 km 15

32 georeferenced · 128 without coordinates

Open the institutions mapphysical evidence160

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelphlocation not on record	53
St. Paul, US	32
Lubbock, US	16
Agency of Natural Resources Department of Forests, Parks and Recreationlocation not on record	13
SOVTlocation not on record	12
University Park, US	9
Denver, US	4
ASUlocation not on record	4
University of Central Floridalocation not on record	3
College Station, US	2
CUlocation not on record	1
Wuzhou, CN	1
OSUClocation not on record	1
Natural History Museum of Utahlocation not on record	1
Lexington, US	1
Cornell University Insect Collectionlocation not on record	1

16 institutions · 154 of 160 vouchered records shown · 4 without an institution code

09Environmental DNA11 detections

Where the DNA of Agrilus obsoletoguttatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map1 country0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.0 °C -4.40–20.9

Seasonal swing summer↔winter30.7 °C

Max temp (day)23.7 °C -1.10–25.9

Min temp (night)15.0 °C -6.50–16.5

Precipitation90.3 mm/mo 54.0–102

Air humidity59.6 % 56.7–65.1

Moisture balance-49.5 mm/mo -69.8–-1.80

Vapour deficit948 Pa 269–992

Wind speed2.70 m/s 2.70–5.60

Cloud cover42.7 % 42.5–57.6

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)