Agrilus euonymi

Tôyama, 1985 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Agrilus

At a glance

Occurrence records25

Data sources7

Biological traits0

DNA specimens21

eDNA detections20

Sources7 archives

Databases and archives Agrilus euonymi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility25 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF25 records

Environmental DNA1 datasets · 2 countries20 detections

DNA & barcodingBOLD21 specimens

01Narrative

Agrilus euonymi é uma espécie de inseto do género Agrilus, família Buprestidae, ordem Coleoptera. Foi descrita cientificamente por Tôyama, 1985.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrilus euonymi has left across the world's sequence archives.

At a glance

DNA specimens21

BINs2

Marker genes2

eDNA detections20

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P620 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 86% of positions are identical in every specimen.

Where individuals differ — all 87 variable positions, in barcode order

6Cmostly conserved

27Cmostly conserved

30Amostly conserved

36Amostly conserved

39Gmostly conserved

42Gmostly conserved

48Amostly conserved

55Tmostly conserved

60Tmostly conserved

66Tmostly conserved

81Amostly conserved

84Cmostly conserved

102Gmostly conserved

108Tmostly conserved

111Tmostly conserved

124Amostly conserved

144Tmostly conserved

159Gvariable

165Amostly conserved

171Tmostly conserved

177Amostly conserved

178Cmostly conserved

180Amostly conserved

183Amostly conserved

187Cmostly conserved

207Cmostly conserved

213Cmostly conserved

216Cmostly conserved

219Cmostly conserved

244Tmostly conserved

249Tmostly conserved

252Amostly conserved

255Tmostly conserved

258Amostly conserved

259Cmostly conserved

268Cmostly conserved

270Tmostly conserved

283Tmostly conserved

300Amostly conserved

306Amostly conserved

312Gmostly conserved

318Tmostly conserved

327Amostly conserved

336Cmostly conserved

339Cmostly conserved

354Gmostly conserved

357Cmostly conserved

360Amostly conserved

369Gmostly conserved

372Cmostly conserved

393Tmostly conserved

396Amostly conserved

397Amostly conserved

402Tmostly conserved

405Tmostly conserved

409Tmostly conserved

414Amostly conserved

429Tmostly conserved

441Tmostly conserved

447Avariable

453Gmostly conserved

456Tmostly conserved

458Gmostly conserved

459Tmostly conserved

471Tmostly conserved

483Amostly conserved

484Cmostly conserved

486Cmostly conserved

489Amostly conserved

495Amostly conserved

498Tvariable

501Tmostly conserved

504Tmostly conserved

507Amostly conserved

514Tmostly conserved

517Tmostly conserved

522Amostly conserved

525Gmostly conserved

528Avariable

534Amostly conserved

552Cmostly conserved

555Cmostly conserved

567Tmostly conserved

570Tmostly conserved

585Cmostly conserved

612Amostly conserved

615Tmostly conserved

GGTGCCTGATCAGGAATAGTAGGAACCGCATTAAGATTGTTGGTACGAGCAGAATTAGGTAACCCTGGAGCCTTAATTGGAAACGACCAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.3%

Haplotypes4

BINs2

Most divergent pair12.4%

AsiaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Phaenops intrusasame family14.7%Agrilus roscidussame genus15.0%Hydrosmecta longulasame order15.8%Neoascia interruptasame order16.3%Rachispoda spulerisame order16.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type25 records

Wild obs. + sensor16

Museum / vouchered9

Range

Area of Occupancy AOO92 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy13% within 1 km

≤100 m 1>10 km 7

8 georeferenced · 8 without coordinates

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 9 records without

Open the institutions mapphysical evidence9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chiba, JP	2
Kushiro City Museumlocation not on record	1
Sagamihara, JP	1

3 institutions · 4 of 9 vouchered records shown · 3 without an institution code

09Environmental DNA20 detections

Where the DNA of Agrilus euonymi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.2 °C 7.30–22.2

Seasonal swing summer↔winter24.3 °C

Max temp (day)24.0 °C 11.5–25.4

Min temp (night)14.9 °C 2.90–17.4

Precipitation123 mm/mo 88.5–209

Air humidity59.8 % 56.6–63.2

Moisture balance-8.40 mm/mo -9.10–66.7

Vapour deficit1,023 Pa 492–1,070

Wind speed1.50 m/s 1.40–2.90

Cloud cover33.8 % 29.5–52.9

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)