Agrilus decoloratus

Kerremans, 1892 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Agrilus

At a glance

Occurrence records38

Data sources6

Biological traits0

DNA specimens5

eDNA detections2

Sources6 archives

Databases and archives Agrilus decoloratus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility38 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF38 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD5 specimens

01Narrative

Agrilus decoloratus é uma espécie de inseto do género Agrilus, família Buprestidae, ordem Coleoptera. Foi descrita cientificamente por Kerremans, 1892.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrilus decoloratus has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes2

eDNA detections2

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P620 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 83% of positions are identical in every specimen.

Diversity (π)8.7%

Haplotypes2

BINs2

Most divergent pair17.4%

Where individuals differ — all 108 variable positions, in barcode order

3Amostly conserved

12Amostly conserved

21Gmostly conserved

27Tmostly conserved

30Tmostly conserved

31Cmostly conserved

37Tmostly conserved

39Amostly conserved

42Amostly conserved

55Tmostly conserved

60Amostly conserved

69Gmostly conserved

72Amostly conserved

73Cmostly conserved

75Tmostly conserved

78Tmostly conserved

81Tmostly conserved

84Tmostly conserved

93Tmostly conserved

99Tmostly conserved

102Cmostly conserved

108Gmostly conserved

111Amostly conserved

114Cmostly conserved

117Cmostly conserved

120Amostly conserved

126Tmostly conserved

141Amostly conserved

162Gmostly conserved

165Amostly conserved

183Cmostly conserved

186Tmostly conserved

189Amostly conserved

193Cmostly conserved

195Amostly conserved

198Tmostly conserved

204Amostly conserved

207Cmostly conserved

216Cmostly conserved

219Cmostly conserved

228Tmostly conserved

231Tmostly conserved

247Tmostly conserved

249Amostly conserved

255Gmostly conserved

258Cmostly conserved

264Tmostly conserved

265Tmostly conserved

268Cmostly conserved

270Tmostly conserved

283Tmostly conserved

288Tmostly conserved

291Gmostly conserved

312Amostly conserved

315Amostly conserved

321Tmostly conserved

327Cmostly conserved

328Cmostly conserved

330Amostly conserved

333Amostly conserved

336Cmostly conserved

354Gmostly conserved

355Gmostly conserved

360Amostly conserved

366Cmostly conserved

367Tmostly conserved

372Tmostly conserved

393Tmostly conserved

399Tmostly conserved

411Gmostly conserved

438Amostly conserved

447Amostly conserved

450Amostly conserved

453Tmostly conserved

454Tmostly conserved

456Tmostly conserved

459Gmostly conserved

466Cmostly conserved

468Tmostly conserved

471Tmostly conserved

474Amostly conserved

476Cmostly conserved

477Cmostly conserved

489Tmostly conserved

504Cmostly conserved

507Amostly conserved

511Tmostly conserved

513Gmostly conserved

514Tmostly conserved

517Tmostly conserved

519Amostly conserved

529Tmostly conserved

534Tmostly conserved

537Amostly conserved

538Tmostly conserved

543Amostly conserved

549Amostly conserved

555Tmostly conserved

561Tmostly conserved

562Tmostly conserved

567Gmostly conserved

570Cmostly conserved

577Tmostly conserved

582Tmostly conserved

588Tmostly conserved

594Tmostly conserved

612Amostly conserved

618Amostly conserved

GGAGCTTGGTCAGGAATAGTGGGAACTGCTCTAAGATTATTAATTCGAGCCGAATTAGGAAATCCTGGGGCACTTATTGGTAATGATCAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Chrysobothris malisame family14.8%Onthophagus gibbulussame order15.6%Agrilus roscidussame genus16.3%Agrilus kubanisame genus16.3%Agrilus viridicaerulanssame genus16.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type38 records

Wild obs. + sensor32

Museum / vouchered6

Range

Area of Occupancy AOO128 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy18% within 1 km

≤100 m 4≤10 km 1>10 km 17

22 georeferenced · 10 without coordinates

Open the mapobservation + sensor32

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 6 records without

Open the institutions mapphysical evidence6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NSMKlocation not on record	2
Kushiro City Museumlocation not on record	2
EJCBlocation not on record	1
Chiba, JP	1

4 institutions · 6 of 6 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Agrilus decoloratus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)