Agrilus cyaneoniger

Saunders, 1873 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Agrilus

At a glance

Occurrence records244

Data sources7

Biological traits0

DNA specimens21

eDNA detections21

Sources7 archives

Databases and archives Agrilus cyaneoniger's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility244 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF244 records

Environmental DNA1 datasets · 2 countries21 detections

DNA & barcodingBOLD21 specimens

01Narrative

Agrilus cyaneoniger é uma espécie de inseto do género Agrilus, família Buprestidae, ordem Coleoptera. Foi descrita cientificamente por Saunders, 1873.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrilus cyaneoniger has left across the world's sequence archives.

At a glance

DNA specimens21

BINs2

Marker genes2

eDNA detections21

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P620 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 38 variable positions, in barcode order

15Cmostly conserved

18Gmostly conserved

27Tmostly conserved

40Tmostly conserved

75Tmostly conserved

84Tmostly conserved

126Cmostly conserved

129Amostly conserved

159Gmostly conserved

178Tmostly conserved

180Amostly conserved

198Cmostly conserved

207Cmostly conserved

210Gmostly conserved

252Cmostly conserved

264Cmostly conserved

300Cmostly conserved

324Tmostly conserved

327Amostly conserved

348Tmostly conserved

372Cmostly conserved

381Gmostly conserved

388Tmostly conserved

399Tmostly conserved

414Tmostly conserved

465Cmostly conserved

477Cmostly conserved

516Amostly conserved

519Tmostly conserved

558Amostly conserved

561Tmostly conserved

570Cmostly conserved

577Cmostly conserved

588Amostly conserved

606Tmostly conserved

609Amostly conserved

612Tmostly conserved

615Cmostly conserved

GGAGCCTGATCAGGCATGGTAGGAACTGCTCTTAGATTGTTAATTCGTGCAGAATTAGGAAACCCAGGAGCTCTTATCGGAAATGACCAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.0%

Haplotypes9

BINs2

Most divergent pair7.4%

AsiaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrilus biguttatussame genus15.0%Agrilus quadrisignatussame genus15.8%Agrilus euonymisame genus16.5%Taphrocerus nicolayisame family16.8%Anthaxia quadripunctatasame family17.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type244 records

Wild obs. + sensor53

Museum / vouchered191

Range

Area of Occupancy AOO516 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy18% within 1 km

≤100 m 4≤10 km 5>10 km 13

22 georeferenced · 31 without coordinates

Open the mapobservation + sensor53

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy97% within 1 km

≤1 km 31≤10 km 1

32 georeferenced · 159 without coordinates

Open the institutions mapphysical evidence191

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chiba, JP	31
Iwate Prefectural Museumlocation not on record	27
Sanda, JP	19
Kushiro City Museumlocation not on record	18
Sagamihara, JP	16
Yamaguchi-shi, JP	14
EJCBlocation not on record	12
Tomioka, JP	11
Omogo Mountain Museumlocation not on record	5
NSMKlocation not on record	5
Bando, JP	5
RCMlocation not on record	3
Nagatoro-machi, Chichibu-gun, JP	2
Zoological Institute, Russian Academy of Scienceslocation not on record	2
RAPClocation not on record	2
Muzeum Górnośląskie w Bytomiulocation not on record	1
Toyota city nature sanctuarylocation not on record	1
Canadian Food Inspection Agency / Genotyping/Botanylocation not on record	1
Museo di Storia naturale della Maremmalocation not on record	1
Zoological Museum, University of Amoylocation not on record	1
BUJClocation not on record	1
Tokushima, JP	1

22 institutions · 179 of 191 vouchered records shown · 10 without an institution code

09Environmental DNA21 detections

Where the DNA of Agrilus cyaneoniger was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.7 °C -0.6–18.5

Seasonal swing summer↔winter33.6 °C

Max temp (day)18.1 °C 3.30–22.4

Min temp (night)9.60 °C -5.30–15.1

Precipitation125 mm/mo 41.7–142

Air humidity63.2 % 60.7–66.6

Moisture balance6.20 mm/mo -26.3–26.5

Vapour deficit578 Pa 385–726

Wind speed2.60 m/s 2.00–4.20

Cloud cover48.1 % 47.0–57.7

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)