Agonum punctiforme

(Say, 1823) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Agonum

At a glance

Occurrence records3 146

Data sources6

Biological traits0

DNA specimens90

eDNA detections82

Sources6 archives

Databases and archives Agonum punctiforme's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 146 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI82 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics90 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 146 records

Environmental DNA1 datasets · 2 countries82 detections

DNA & barcodingBOLD90 specimens

01Narrative

Agonum punctiforme is a species of ground beetle in the family Carabidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding90 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonum punctiforme has left across the world's sequence archives.

At a glance

DNA specimens90

BINs1

Marker genes1

eDNA detections82

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus79 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

58Amostly conserved

316Gmostly conserved

361Tvariable

370Cmostly conserved

433Gmostly conserved

619Gmostly conserved

TACATTATACTTTATTTTCGGAGCATGATCAGGAATAGTAGGGACTTCATTAAGTATATTAATTCGAGCTGAATTAGGAAATCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.43%

Haplotypes33

BIN1

Most divergent pair1.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonum cupripennesame genus7.6%Agonum moerenssame genus7.9%Agonum octopunctatumsame genus7.9%Agonum mutatumsame genus7.9%Agonum harrisiisame genus7.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 146 records

Wild obs. + sensor1 543

Museum / vouchered1 603

Range

Area of Occupancy AOO4 400 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 832≤1 km 189≤10 km 36>10 km 247

1 304 georeferenced · 239 without coordinates

Open the mapobservation + sensor1 543

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 200≤1 km 132≤10 km 121>10 km 108

561 georeferenced · 1 042 without coordinates

Open the institutions mapphysical evidence1 603

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	649
Tempe, US	209
College Station, US	142
Lubbock, US	97
Lexington, US	88
Colorado State Universitylocation not on record	65
OSUClocation not on record	45
University Park, US	41
Mississippi State, US	37
Wuzhou, CN	36
Sam Noble Oklahoma Museum of Natural Historylocation not on record	30
Provo, US	26
CUlocation not on record	23
Santa Barbara Museum of Natural Historylocation not on record	18
Royal Saskatchewan Museumlocation not on record	15
Champaign, US	15
University of Alabamalocation not on record	15
North Carolina State University Insect Museumlocation not on record	13
Cambridge, US	6
Washington, US	4
Essig Museum of Entomologylocation not on record	4
NEON Biorepository at Arizona State Universitylocation not on record	3
San Francisco, US	3
Cape Town, ZA	2
ASUlocation not on record	2
Blacksburg, US	2
Chicago, US	2
Essig Museum of Entomologylocation not on record	1
Decorah, US	1
UDlocation not on record	1
EWIClocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

32 institutions · 1 597 of 1 603 vouchered records shown · 4 without an institution code

09Environmental DNA82 detections

Where the DNA of Agonum punctiforme was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found82

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 82 detections have coordinates

Open the map2 countries0

cultivatedCropsgrasslandHerbaceouswoodyWetlandsdeciduousForestCorn

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.6 °C 12.5–25.7

Seasonal swing summer↔winter23.6 °C

Max temp (day)24.4 °C 17.2–31.6

Min temp (night)14.0 °C 8.20–21.4

Precipitation96.7 mm/mo 71.5–114

Air humidity57.1 % 54.2–58.7

Moisture balance-38.4 mm/mo -90.4–-0.5

Vapour deficit963 Pa 663–1,455

Wind speed4.00 m/s 2.40–5.70

Cloud cover36.9 % 27.5–44.4

CHELSA 1981–2010, ~9 km grid, at location & month of 81 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agonum punctiforme

At a glance

Sources6 archives

At a glance

Record type3 146 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions16 of 32 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 146 records