Agonum limbatum

Motschulsky, 1845 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Agonum

At a glance

Occurrence records268

Data sources4

Biological traits0

DNA specimens23

eDNA detections18

Sources4 archives

Databases and archives Agonum limbatum's data was compiled from.

GBIFGlobal Biodiversity Information Facility268 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF268 records

Environmental DNA1 datasets · 1 countries18 detections

DNA & barcodingBOLD23 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonum limbatum has left across the world's sequence archives.

At a glance

DNA specimens23

BINs1

Marker genes1

eDNA detections18

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

106Cmostly conserved

142Tmostly conserved

181Amostly conserved

202Tvariable

205Tmostly conserved

211Gmostly conserved

217Gmostly conserved

223Cvariable

229Amostly conserved

415Gvariable

433Gvariable

508Gvariable

565Amostly conserved

571Tmostly conserved

622Cvariable

628Amostly conserved

631Amostly conserved

AACTTTATATTTTATCTTTGGTGCATGAGCAGGAATAGTAGGAACTTCATTAAGTATACTAATTCGAGCTGAATTAGGAAATCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.88%

Haplotypes10

BIN1

Most divergent pair1.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonum marginatumsame genus5.8%Agonum muellerisame genus5.9%Agonum gracilipessame genus6.1%Agonum placidumsame genus6.2%Agonum ferruginosumsame genus6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type268 records

Wild obs. + sensor19

Museum / vouchered249

Range

Area of Occupancy AOO288 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 15≤1 km 3≤10 km 1

19 georeferenced

Open the mapobservation + sensor19

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 4≤1 km 1≤10 km 4

9 georeferenced · 240 without coordinates

Open the institutions mapphysical evidence249

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Francisco, US	174
Santa Barbara Museum of Natural Historylocation not on record	59
NEON Biorepository at Arizona State Universitylocation not on record	7
Essig Museum of Entomologylocation not on record	4
Provo, US	3
Colorado State Universitylocation not on record	1
Champaign, US	1

7 institutions · 249 of 249 vouchered records shown

09Environmental DNA18 detections

Where the DNA of Agonum limbatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map1 country0

grasslandHerbaceousevergreenForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 9.10–17.2

Seasonal swing summer↔winter18.5 °C

Max temp (day)16.9 °C 14.1–24.2

Min temp (night)7.50 °C 3.20–12.5

Precipitation65.2 mm/mo 16.3–115

Air humidity52.2 % 47.4–62.1

Moisture balance-71.6 mm/mo

Vapour deficit619 Pa 488–1,051

Wind speed1.90 m/s

Cloud cover33.0 % 24.5–44.5

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)