Agonum placidum

(Say, 1823) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Agonum

At a glance

Occurrence records3 226

Data sources7

Biological traits0

DNA specimens68

eDNA detections64

Sources7 archives

Databases and archives Agonum placidum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 226 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI64 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics68 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 226 records

Environmental DNA1 datasets · 3 countries64 detections

DNA & barcodingBOLD68 specimens

01Narrative

Agonum placidum is a species of black coloured ground beetle in the Platyninae subfamily that can be found in woodlands, thickets, and open fields of southern Canada and northeastern United States.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding68 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonum placidum has left across the world's sequence archives.

At a glance

DNA specimens68

BINs1

Marker genes1

eDNA detections64

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus52 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

58Gvariable

373Amostly conserved

397Cmostly conserved

415Amostly conserved

433Gmostly conserved

508Gmostly conserved

562Amostly conserved

622Amostly conserved

AACATTATATTTTATTTTTGGTGCATGAGCTGGAATAGTAGGAACTTCATTAAGTATGCTAATTCGAGCTGAATTAGGAAATCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.51%

Haplotypes13

BIN1

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonum gracilipessame genus2.6%Agonum muellerisame genus5.3%Anchomenus dorsalissame family5.9%Agonum monachumsame genus5.9%Agonum marginatumsame genus5.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 226 records

Wild obs. + sensor103

Museum / vouchered3 123

Range

Area of Occupancy AOO2 408 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 64≤1 km 16≤10 km 4>10 km 9

93 georeferenced · 10 without coordinates

Open the mapobservation + sensor103

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 373≤1 km 85≤10 km 385>10 km 75

918 georeferenced · 2 205 without coordinates

Open the institutions mapphysical evidence3 123

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	1 089
WIlocation not on record	579
Tempe, US	323
University Park, US	194
Royal Saskatchewan Museumlocation not on record	176
OSUClocation not on record	137
Colorado State Universitylocation not on record	85
Provo, US	85
Espace pour la vielocation not on record	65
Albuquerque, US	60
University of Alabamalocation not on record	46
Decorah, US	42
Essig Museum of Entomologylocation not on record	30
Saint John, CA	12
UDlocation not on record	8
University of Guelphlocation not on record	7
NEON Biorepository at Arizona State Universitylocation not on record	5
Champaign, US	5
Sam Noble Oklahoma Museum of Natural Historylocation not on record	4
CASlocation not on record	4
EWIClocation not on record	4
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
North Carolina State University Insect Museumlocation not on record	4
Lexington, US	3
Awka, NG	2
Lubbock, US	2
College Station, US	2
Museu Nacional de História Natural e da Ciêncialocation not on record	2
Denver, US	2
US	2
Universidad Católica de Manizaleslocation not on record	1
ASUlocation not on record	1
New Haven, US	1
CUlocation not on record	1
Cambridge, US	1

35 institutions · 2 988 of 3 123 vouchered records shown · 135 without an institution code

09Environmental DNA64 detections

Where the DNA of Agonum placidum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found64

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 64 detections have coordinates

Open the map3 countries0

Temperate mixed forestcultivatedCropsgrasslandHerbaceousevergreenForest14. Artificial - Terrestrial|14.1 Arable LandForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 7.30–22.0

Seasonal swing summer↔winter31.1 °C

Max temp (day)21.9 °C 12.7–28.6

Min temp (night)11.0 °C 2.80–16.1

Precipitation76.3 mm/mo 40.8–87.4

Air humidity55.3 % 51.6–58.0

Moisture balance-59.2 mm/mo -109–-35.0

Vapour deficit775 Pa 541–1,191

Wind speed4.30 m/s 2.80–4.80

Cloud cover38.5 % 20.7–45.2

CHELSA 1981–2010, ~9 km grid, at location & month of 60 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agonum placidum

At a glance

Sources7 archives

At a glance

Record type3 226 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 35 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 226 records