Agonopterix yeatiana

Fabricius, 1781 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Agonopterix

At a glance

Occurrence records2 354

Data sources8

Biological traits0

DNA specimens32

eDNA detections35

Sources8 archives

Databases and archives Agonopterix yeatiana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 354 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI35 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics32 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 354 records

Environmental DNA3 datasets · 12 countries35 detections

DNA & barcodingBOLD32 specimens

Genome at a glanceGoaT · NCBI≈698 Mbp

01Narrative

De peenkaartmot is een vlinder uit de familie grasmineermotten (Elachistidae). De wetenschappelijke naam is voor het eerst geldig gepubliceerd in 1781 door Fabricius. De soort komt voor in Europa.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding32 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonopterix yeatiana has left across the world's sequence archives.

At a glance

DNA specimens32

BINs1

Marker genes1

eDNA detections35

Countries13

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus30 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

212Cvariable

229Gmostly conserved

514Tvariable

550Avariable

619Tmostly conserved

628Gvariable

634Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGTGCCGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.79%

Haplotypes9

BIN1

Most divergent pair1.8%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonopterix straminellasame genus4.0%Agonopterix coenosellasame genus4.0%Agonopterix adspersellasame genus4.1%Agonopterix ochrocephalasame genus4.1%Agonopterix broennoeensissame genus4.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Agonopterix yeatiana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈698 441 364 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Agonopterix yeatiana0.70 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.6% BUSCO

08Occurrence & distribution

Record type2 354 records

Wild obs. + sensor2 140

Museum / vouchered166

Other48

Origin

Native17

Range

Area of Occupancy AOO3 508 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy31% within 1 km

≤100 m 463≤1 km 141≤10 km 1 306>10 km 12

1 922 georeferenced · 218 without coordinates

Open the mapobservation + sensor2 140

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤100 m 80≤1 km 30≤10 km 47

157 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence166

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	117
Provincia di Livornolocation not on record	16
Natural History Museum Rotterdamlocation not on record	8
SLU Artdatabankenlocation not on record	4
Tilburg, NL	4
Tartu, EE	3
Salzburg, AT	3
Radicondoli, IT	3
Nijmegen, NL	1
Research Collection of Kai Berggrenlocation not on record	1
South Kensington, GB	1

11 institutions · 161 of 166 vouchered records shown · 5 without an institution code

09Environmental DNA35 detections

Where the DNA of Agonopterix yeatiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found35

Studies independent surveys3

Countries12

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 35 detections have coordinates

Open the map12 countries0

1. Forest & Woodland | 1.4. Temperate Forestmixed meadow/scrub/orange plantationwet forest/swamp

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.5 °C 5.70–23.2

Seasonal swing summer↔winter16.0 °C

Max temp (day)19.5 °C 9.40–27.9

Min temp (night)11.6 °C 1.30–18.5

Precipitation51.5 mm/mo 18.3–135

Air humidity58.7 % 53.2–63.0

Moisture balance-42.6 mm/mo -150–48.3

Vapour deficit693 Pa 376–1,227

Wind speed3.20 m/s 1.70–5.60

Cloud cover37.8 % 29.2–45.0

CHELSA 1981–2010, ~9 km grid, at location & month of 33 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agonopterix yeatiana

At a glance

Sources8 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 354 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 11 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 354 records