Agonopterix adspersella

(Kollar, 1832) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Agonopterix

At a glance

Occurrence records53

Data sources7

Biological traits0

DNA specimens52

eDNA detections25

Sources7 archives

Databases and archives Agonopterix adspersella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility53 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI25 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics52 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF53 records

Environmental DNA1 datasets · 9 countries25 detections

DNA & barcodingBOLD52 specimens

01Narrative

Agonopterix adspersella is a moth of the family Depressariidae. It is found in southern Europe, Asia Minor, the Palestinian Territories, Iran and the Crimea.Dritter Nachtrag zur Mikrolepidopterenfauna Zyperns The larvae feed on Bupleurum falcatum. They spin the leaves of their host plant together to create a shelter from which they feed. Pupation takes place on the ground in a spinning of sand grains.lepiforum.de

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding52 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonopterix adspersella has left across the world's sequence archives.

At a glance

DNA specimens52

BINs3

Marker genes1

eDNA detections25

Countries15

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus49 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

38Gvariable

82Tvariable

85Amostly conserved

106Tvariable

229Avariable

235Cvariable

400Amostly conserved

430Avariable

451Cvariable

463Tmostly conserved

508Avariable

514Tvariable

529Amostly conserved

530Cvariable

536Cvariable

544Avariable

565Avariable

571Tvariable

586Avariable

622Tmostly conserved

628Tvariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCTTTAAGATTATTAATTCGTGCTGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes15

BINs3

Most divergent pair3.0%

EuropeAsiaAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonopterix cadurciellasame genus2.4%Agonopterix ivinskisisame genus2.6%Agonopterix kayseriensissame genus2.6%Agonopterix leucadensissame genus2.6%Agonopterix straminellasame genus2.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type53 records

Wild obs. + sensor21

Museum / vouchered19

Other13

Range

Area of Occupancy AOO144 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 11≤1 km 2≤10 km 7

20 georeferenced · 1 without coordinates

Open the mapobservation + sensor21

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 6

6 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence19

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Provincia di Livornolocation not on record	6
Research Collection of K. & T. Nupponenlocation not on record	1
ZSMlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
Natural History Museum Vienna, Research Collectionlocation not on record	1

5 institutions · 10 of 19 vouchered records shown · 9 without an institution code

09Environmental DNA25 detections

Where the DNA of Agonopterix adspersella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found25

Studies independent surveys1

Countries9

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 25 detections have coordinates

Open the map9 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.3 °C 10.9–22.9

Seasonal swing summer↔winter17.0 °C

Max temp (day)23.0 °C 14.8–26.9

Min temp (night)12.6 °C 6.20–18.0

Precipitation53.6 mm/mo 18.7–89.9

Air humidity56.3 % 52.9–62.1

Moisture balance-86.7 mm/mo -152–0.3

Vapour deficit938 Pa 528–1,260

Wind speed2.90 m/s 1.60–4.30

Cloud cover35.2 % 31.1–44.4

CHELSA 1981–2010, ~9 km grid, at location & month of 24 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)