Agonopterix psoraliella

Walsingham, 1881 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Agonopterix

At a glance

Occurrence records23

Data sources7

Biological traits0

DNA specimens5

eDNA detections7

Sources7 archives

Databases and archives Agonopterix psoraliella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility23 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF23 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD5 specimens

01Narrative

Agonopterix psoraliella is a moth in the family Depressariidae. It was described by Walsingham in 1881. It is found in North America, where it has been recorded from California to Washington, Utah, South Dakota and Arizona.mothphotographersgroup The wingspan is 20–24 mm. The forewings are deep red-brown, irrorated with blackish fuscous and grey. There are two small yellowish discal dots at the basal third, followed by another at the end of the cell. All spots are edged with deep red. There is a series of indistinct blackish-fuscous spots along the costa and around the termen. The hindwings are dark greyish-fuscous.Proceedings of the United States National Museum The larvae feed on Psoralea lanceolata and Psoralea physodes.Agonopterix at funet

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonopterix psoraliella has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections7

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.56%

Haplotypes2

BIN1

Most divergent pair0.91%

Where individuals differ — all 6 variable positions, in barcode order

85Avariable

190Amostly conserved

238Cvariable

278Tmostly conserved

313Tmostly conserved

622Cmostly conserved

CACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGTAATCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonopterix scopariellasame genus5.2%Agonopterix oregonensissame genus5.4%Agonopterix atomellasame genus5.6%Agonopterix straminellasame genus5.6%Agonopterix argillaceasame genus5.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type23 records

Museum / vouchered23

Range

Area of Occupancy AOO16 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence23

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	20
Philadelphia, US	1
Vernal, US	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

4 institutions · 23 of 23 vouchered records shown

09Environmental DNA7 detections

Where the DNA of Agonopterix psoraliella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.9 °C 11.7–17.4

Seasonal swing summer↔winter21.6 °C

Max temp (day)23.7 °C 18.3–24.6

Min temp (night)8.90 °C 4.50–10.0

Precipitation45.1 mm/mo 14.2–50.6

Air humidity45.9 % 40.3–46.6

Moisture balance-129 mm/mo -148–-77.4

Vapour deficit1,043 Pa 796–1,193

Wind speed2.60 m/s 1.90–3.20

Cloud cover21.0 % 12.6–27.3

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)