Agonopterix propinquella

(Treitschke, 1835) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Agonopterix

At a glance

Occurrence records3 529

Data sources9

Biological traits2

DNA specimens35

eDNA detections40

Sources9 archives

Databases and archives Agonopterix propinquella's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 529 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI40 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics35 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF3 529 records

Environmental DNA2 datasets · 11 countries40 detections

DNA & barcodingBOLD35 specimens

Genome at a glanceGoaT · NCBI≈568 Mbp

01Narrative

Agonopterix propinquella is a species of moth of the family Depressariidae. It is found in Europe. The wingspan is 16–19 mm. Adults are on wing from September to July depending on the location. The larvae feed on Arctium, Carduus, Centaurea, Cirsium arvense, Cirsium vulgare, Cynara, Mycelis muralis and Serratula. They initially mine the leaves of their host plant. Larvae can be found from July to early August. They are apple green with a black head.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding35 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonopterix propinquella has left across the world's sequence archives.

At a glance

DNA specimens35

BINs4

Marker genes1

eDNA detections40

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus31 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

166Gmostly conserved

202Amostly conserved

220Cvariable

278Cmostly conserved

310Avariable

313Tmostly conserved

364Tmostly conserved

477Avariable

484Amostly conserved

500Tmostly conserved

574Amostly conserved

583Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGTACATCTTTAAGATTATTAATTCGTGCTGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.88%

Haplotypes7

BINs4

Most divergent pair6.2%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonopterix straminellasame genus3.2%Agonopterix broennoeensissame genus3.3%Agonopterix putridellasame genus3.3%Agonopterix kayseriensissame genus3.6%Agonopterix atomellasame genus3.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Agonopterix propinquella carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈568 016 808 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Agonopterix propinquella0.57 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.7% BUSCO

08Occurrence & distribution

Record type3 529 records

Wild obs. + sensor2 844

Museum / vouchered668

Other17

Origin

Native22

Range

Area of Occupancy AOO5 980 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy56% within 1 km

≤100 m 901≤1 km 592≤10 km 1 176>10 km 8

2 677 georeferenced · 167 without coordinates

Open the mapobservation + sensor2 844

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 152≤1 km 159≤10 km 278>10 km 10

599 georeferenced · 69 without coordinates

Open the institutions mapphysical evidence668

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	281
Provincia di Livornolocation not on record	45
NHMOlocation not on record	37
SLU Artdatabankenlocation not on record	27
Tartu, EE	25
DanishLepidopterologicalSocietylocation not on record	21
Tilburg, NL	16
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	9
Rovaniemi, FI	8
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	8
Nijmegen, NL	6
Natural History Museum Rotterdamlocation not on record	6
KIRMlocation not on record	5
University of Kaiserslauternlocation not on record	5
Stockholm, SE	5
Salzburg, AT	4
ZSMlocation not on record	3
Philadelphia, US	3
Kuopio, FI	2
Tallinn, EE	2
Trondheim, NO	1
South Kensington, GB	1
ZMAAlocation not on record	1
University of Copenhagen, Natural History Museum of Denmark, Zoological Museumlocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1
Research Collection of Peter Buchnerlocation not on record	1
Tiroler Landesmuseum Ferdinandeumlocation not on record	1

27 institutions · 525 of 668 vouchered records shown · 143 without an institution code

09Environmental DNA40 detections

Where the DNA of Agonopterix propinquella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found40

Studies independent surveys2

Countries11

Verifiable raw sequence linked8

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 40 detections have coordinates

Open the map11 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.9 °C 7.00–18.8

Seasonal swing summer↔winter19.8 °C

Max temp (day)17.7 °C 11.5–23.2

Min temp (night)9.00 °C 2.40–13.8

Precipitation76.0 mm/mo 36.8–121

Air humidity59.6 % 57.4–63.1

Moisture balance-23.8 mm/mo -53.3–29.8

Vapour deficit604 Pa 430–904

Wind speed2.80 m/s 2.00–4.00

Cloud cover41.4 % 33.7–49.9

CHELSA 1981–2010, ~9 km grid, at location & month of 39 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agonopterix propinquella

At a glance

Sources9 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type3 529 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 529 records