Agonopterix putridella

(Denis & Schiffermüller) , 1775 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Agonopterix

At a glance

Occurrence records53

Data sources7

Biological traits2

DNA specimens22

eDNA detections12

Sources7 archives

Databases and archives Agonopterix putridella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility53 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF53 records

Environmental DNA1 datasets · 4 countries12 detections

DNA & barcodingBOLD22 specimens

01Narrative

Agonopterix putridella is a moth of the family Depressariidae. It is found in Great Britain, France, Germany, Switzerland, Austria, the Czech Republic, Hungary, Romania, Ukraine and Russia. A piece of Peucedanum officinale leaf attacked by larva Larva The wingspan is 15–18 mm.Hants Moths Adults are on wing from July to August. The larvae feed on Peucedanum species, including Peucedanum officinale, Peucedanum cervaria and Peucedanum alsaticum. They feed in an untidy gathering or spinning of leaves of the host plant. Larvae can be found from May to June.UKmoths

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonopterix putridella has left across the world's sequence archives.

At a glance

DNA specimens22

BINs2

Marker genes1

eDNA detections12

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

34Cvariable

88Avariable

118Tvariable

200Gmostly conserved

271Cvariable

274Cvariable

278Cvariable

280Amostly conserved

367Tmostly conserved

368Avariable

375Gvariable

385Tvariable

401Tvariable

403Avariable

460Cvariable

466Amostly conserved

475Cvariable

583Cvariable

601Tmostly conserved

616Cvariable

628Amostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGCATAGTAGGAACATCTTTAAGATTATTAATTCGTGCTGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes6

BINs2

Most divergent pair2.9%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonopterix septicellasame genus2.0%Agonopterix agyrellasame genus2.1%Agonopterix quadripunctatasame genus2.3%Agonopterix straminellasame genus2.6%Agonopterix kayseriensissame genus3.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type53 records

Wild obs. + sensor31

Museum / vouchered20

Other2

Range

Area of Occupancy AOO152 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy24% within 1 km

≤100 m 2≤1 km 5≤10 km 22

29 georeferenced · 2 without coordinates

Open the mapobservation + sensor31

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 14≤1 km 2

16 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence20

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	14
Tartu, EE	1
BioFokuslocation not on record	1
Provincia di Livornolocation not on record	1
Natural History Museum, Londonlocation not on record	1

5 institutions · 18 of 20 vouchered records shown · 2 without an institution code

09Environmental DNA12 detections

Where the DNA of Agonopterix putridella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.5 °C 11.8–18.1

Seasonal swing summer↔winter16.1 °C

Max temp (day)19.2 °C 16.2–22.2

Min temp (night)13.5 °C 5.00–13.8

Precipitation148 mm/mo 45.7–211

Air humidity60.0 % 58.1–61.9

Moisture balance24.4 mm/mo -82.3–107

Vapour deficit711 Pa 555–871

Wind speed2.70 m/s 2.00–4.80

Cloud cover39.6 % 25.8–49.2

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)