Agonopterix ocellana

Fabricius, 1775 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Agonopterix

At a glance

Occurrence records9 528

Data sources7

Biological traits2

DNA specimens60

eDNA detections216

Sources7 archives

Databases and archives Agonopterix ocellana's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility9 528 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI216 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics60 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF9 528 records

Environmental DNA4 datasets · 12 countries216 detections

DNA & barcodingBOLD60 specimens

01Narrative

Agonopterix ocellana is a species of moth of the family Depressariidae. It is found in Europe and was first described by Johan Christian Fabricius in 1775

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding60 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonopterix ocellana has left across the world's sequence archives.

At a glance

DNA specimens60

BINs1

Marker genes1

eDNA detections216

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus57 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCTTTAAGATTATTAATTCGTGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.05%

Haplotypes5

BIN1

Most divergent pair0.61%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonopterix argillaceasame genus2.7%Agonopterix scopariellasame genus3.0%Agonopterix ochrocephalasame genus3.3%Agonopterix straminellasame genus3.5%Agonopterix carduncellisame genus3.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type9 528 records

Wild obs. + sensor8 100

Museum / vouchered1 330

Other98

Origin

Native11

Range

Area of Occupancy AOO13 988 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 3 457≤1 km 1 908≤10 km 2 152>10 km 18

7 535 georeferenced · 565 without coordinates

Open the mapobservation + sensor8 100

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 396≤1 km 400≤10 km 419>10 km 6

1 221 georeferenced · 109 without coordinates

Open the institutions mapphysical evidence1 330

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	353
DanishLepidopterologicalSocietylocation not on record	292
NHMOlocation not on record	103
Provincia di Livornolocation not on record	81
Tartu, EE	58
SLU Artdatabankenlocation not on record	49
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	35
NTNU-VMlocation not on record	35
Kuopio, FI	29
Salzburg, AT	28
Tilburg, NL	17
Tallinn, EE	11
BioFokuslocation not on record	11
Natural History Museum Rotterdamlocation not on record	11
DABUHlocation not on record	10
KIRMlocation not on record	10
Stockholm, SE	9
Philadelphia, US	8
ZMAAlocation not on record	8
Nijmegen, NL	6
Rovaniemi, FI	5
neflocation not on record	4
European Distributed Institute of Taxonomy (EDIT)location not on record	3
South Kensington, GB	3
Trondheim, NO	2
ZSMlocation not on record	2
Research Collection of Theo Gruenewaldlocation not on record	2
University of Kaiserslauternlocation not on record	2
BOLD, COIlocation not on record	1
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1

31 institutions · 1 190 of 1 330 vouchered records shown · 140 without an institution code

09Environmental DNA216 detections

Where the DNA of Agonopterix ocellana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found216

Studies independent surveys4

Countries12

Verifiable raw sequence linked157

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 216 detections have coordinates

Open the map12 countries0

Farmland, coast and birch habitatGarden, coast and birch habitatFloodplain forestMixed forest on sandy soilwoodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.8 °C 2.50–16.3

Seasonal swing summer↔winter17.8 °C

Max temp (day)14.7 °C 5.40–20.2

Min temp (night)7.20 °C -0.8–12.9

Precipitation67.4 mm/mo 40.9–103

Air humidity62.0 % 58.0–65.3

Moisture balance0.1 mm/mo -48.7–38.3

Vapour deficit507 Pa 255–724

Wind speed3.10 m/s 2.30–5.00

Cloud cover50.2 % 40.4–56.7

CHELSA 1981–2010, ~9 km grid, at location & month of 213 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agonopterix ocellana

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type9 528 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 31 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type9 528 records