Agonopterix heracliana

Linnaeus, 1758 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Agonopterix

At a glance

Occurrence records29 911

Data sources9

Biological traits2

DNA specimens625

eDNA detections1 357

Sources9 archives

Databases and archives Agonopterix heracliana's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility29 911 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 357 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics625 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF29 911 records

Environmental DNA6 datasets · 18 countries1 357 detections

DNA & barcodingBOLD625 specimens

Genome at a glanceGoaT · NCBI≈539 Mbp

01Narrative

Agonopterix heracliana is a moth of the family Depressariidae. It is found in most of Europe, North Africa, the Near East, and the eastern part of the Palearctic realm. It was first described in 1758 by Carl Linnaeus in the 10th edition of Systema Naturae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding625 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonopterix heracliana has left across the world's sequence archives.

At a glance

DNA specimens625

BINs5

Marker genes2

eDNA detections1 357

Countries18

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus471 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

65Avariable

68Tvariable

113Cvariable

131Amostly conserved

195Cmostly conserved

197Avariable

233Tvariable

266Amostly conserved

269Cmostly conserved

383Cvariable

398Amostly conserved

410Tvariable

416Tvariable

440Tmostly conserved

461Tvariable

506Avariable

512Avariable

518Avariable

524Avariable

581Tvariable

620Avariable

626Gmostly conserved

644Tmostly conserved

CATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGTAATCCTGGATCTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes32

BINs5

Most divergent pair6.4%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonopterix orophilellasame genus1.5%Agonopterix rosaciliellasame genus1.8%Agonopterix ciliellasame genus2.0%Agonopterix latipennellasame genus3.7%Agonopterix kayseriensissame genus3.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Agonopterix heracliana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈539 113 803 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Agonopterix heracliana0.54 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type29 911 records

Wild obs. + sensor24 977

Museum / vouchered4 772

Other162

Origin

Native289

Range

Area of Occupancy AOO24 280 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 11 415≤1 km 5 627≤10 km 6 890>10 km 40

23 972 georeferenced · 1 005 without coordinates

Open the mapobservation + sensor24 977

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy66% within 1 km

≤100 m 1 749≤1 km 1 167≤10 km 1 452>10 km 45

4 413 georeferenced · 359 without coordinates

Open the institutions mapphysical evidence4 772

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	1 582
DanishLepidopterologicalSocietylocation not on record	798
NTNU-VMlocation not on record	666
Tartu, EE	202
NHMOlocation not on record	197
Provincia di Livornolocation not on record	141
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	100
SLU Artdatabankenlocation not on record	91
Salzburg, AT	72
Kuopio, FI	60
Philadelphia, US	56
Natural History Museum Rotterdamlocation not on record	48
RMZlocation not on record	42
Stockholm, SE	40
Tallinn, EE	26
BioFokuslocation not on record	23
Tilburg, NL	23
DABUHlocation not on record	21
Rovaniemi, FI	17
neflocation not on record	16
Nijmegen, NL	11
ZMAAlocation not on record	9
European Distributed Institute of Taxonomy (EDIT)location not on record	8
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	8
MZLUlocation not on record	8
University of Kaiserslauternlocation not on record	7
South Kensington, GB	7
Uniwersytet Łódzkilocation not on record	7
Tromsø, NO	6
Wellcome Sanger Institutelocation not on record	5
Metsähallituslocation not on record	3
University of Oslo, Natural History Museumlocation not on record	2
Centre for Biodiversity Genomicslocation not on record	2
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	2
Bavarian State Collection of Zoologylocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1
NTNU University Museum, Department of Natural Historylocation not on record	1
Trondheim, NO	1

38 institutions · 4 310 of 4 772 vouchered records shown · 462 without an institution code

09Environmental DNA1 357 detections

Where the DNA of Agonopterix heracliana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1 357

Studies independent surveys6

Countries18

Verifiable raw sequence linked694

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 357 detections have coordinates

Open the map18 countries0

1. Forest & Woodland | 1.4. Temperate ForestFarmland, coast and birch habitat14. Artificial - Terrestrial | 14.2 Pasturel…Garden, coast and birch habitatGarden and heatland, coastal habitatGarden centre

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.00 °C 2.20–16.5

Seasonal swing summer↔winter17.8 °C

Max temp (day)11.4 °C 4.20–20.0

Min temp (night)4.90 °C -0.4–12.9

Precipitation65.4 mm/mo 40.9–109

Air humidity61.2 % 58.4–65.1

Moisture balance4.90 mm/mo

Vapour deficit431 Pa 260–725

Wind speed4.00 m/s

Cloud cover50.3 % 40.0–57.9

CHELSA 1981–2010, ~9 km grid, at location & month of 1 356 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agonopterix heracliana

At a glance

Sources9 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type29 911 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 38 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type29 911 records