Agonopterix ciliella

Stainton, 1849 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Agonopterix

At a glance

Occurrence records2 456

Data sources6

Biological traits0

DNA specimens120

eDNA detections226

Sources6 archives

Databases and archives Agonopterix ciliella's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 456 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI226 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics120 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 456 records

Environmental DNA4 datasets · 12 countries226 detections

DNA & barcodingBOLD120 specimens

01Narrative

De bonte kaartmot is een vlinder uit de familie grasmineermotten (Elachistidae). De wetenschappelijke naam werd gepubliceerd in 1849 door Stainton. De soort komt voor in Europa.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding120 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonopterix ciliella has left across the world's sequence archives.

At a glance

DNA specimens120

BINs2

Marker genes1

eDNA detections226

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus82 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

100Cvariable

115Cmostly conserved

235Tmostly conserved

274Tvariable

373Tmostly conserved

397Tmostly conserved

412Amostly conserved

514Tmostly conserved

529Gvariable

646Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGTAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.63%

Haplotypes16

BIN1

Most divergent pair2.7%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonopterix heraclianasame genus2.0%Agonopterix orophilellasame genus2.1%Agonopterix coenosellasame genus4.0%Agonopterix latipennellasame genus4.1%Agonopterix alpigenasame genus4.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 456 records

Wild obs. + sensor1 792

Museum / vouchered598

Other66

Origin

Native1

Range

Area of Occupancy AOO4 660 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 801≤1 km 427≤10 km 467>10 km 2

1 697 georeferenced · 95 without coordinates

Open the mapobservation + sensor1 792

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy68% within 1 km

≤100 m 188≤1 km 163≤10 km 123>10 km 42

516 georeferenced · 82 without coordinates

Open the institutions mapphysical evidence598

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	140
NHMOlocation not on record	103
DanishLepidopterologicalSocietylocation not on record	88
NTNU-VMlocation not on record	62
Provincia di Livornolocation not on record	49
SLU Artdatabankenlocation not on record	24
Salzburg, AT	15
Natural History Museum Rotterdamlocation not on record	15
RMZlocation not on record	11
Tartu, EE	10
Rovaniemi, FI	6
KIRMlocation not on record	5
University of Oulu, Zoological Museumlocation not on record	3
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	2
ZMAAlocation not on record	2
South Kensington, GB	2
Tilburg, NL	2
Stockholm, SE	1
University of Oslo, Natural History Museumlocation not on record	1
Kuopio, FI	1
neflocation not on record	1
BioFokuslocation not on record	1
Trondheim, NO	1
Natural History Museum, Londonlocation not on record	1

24 institutions · 546 of 598 vouchered records shown · 52 without an institution code

09Environmental DNA226 detections

Where the DNA of Agonopterix ciliella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found226

Studies independent surveys4

Countries12

Verifiable raw sequence linked94

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 226 detections have coordinates

Open the map12 countries0

Garden centre1. Forest & WoodlandMixed habitatFarmland, coast and birch habitatForestFarmenvironment, farmland, coast and birch h…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.70 °C 1.90–15.1

Seasonal swing summer↔winter18.3 °C

Max temp (day)12.8 °C 4.50–18.8

Min temp (night)4.90 °C -2.80–11.5

Precipitation65.4 mm/mo 47.9–118

Air humidity61.2 % 58.6–66.0

Moisture balance20.0 mm/mo

Vapour deficit436 Pa 262–671

Wind speed3.50 m/s

Cloud cover49.5 % 38.8–60.8

CHELSA 1981–2010, ~9 km grid, at location & month of 221 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agonopterix ciliella

At a glance

Sources6 archives

At a glance

Record type2 456 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 456 records