Agonopterix curvilineella

Beutenmüller, 1889 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Agonopterix

At a glance

Occurrence records473

Data sources7

Biological traits0

DNA specimens44

eDNA detections43

Sources7 archives

Databases and archives Agonopterix curvilineella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility473 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI43 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics44 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF473 records

Environmental DNA1 datasets · 2 countries43 detections

DNA & barcodingBOLD44 specimens

01Narrative

Agonopterix curvilineella, the curved-line agonopterix moth, is a moth in the family Depressariidae. It was described by William Beutenmüller in 1889. It is found in North America, where it has been recorded from Illinois, Indiana, Kentucky, Maine, Maryland, Massachusetts, Michigan, Minnesota, Mississippi, New Brunswick, New York, Ohio, Ontario, Quebec, Tennessee, West Virginia and Wisconsin.Moth Photographers Group at Mississippi State University The wingspan is about 18 mm. The forewings are gray, clouded with grayish-ochreous scales, especially at the base beyond the pale basal field which extends to the costal third. There is a curved black streak on the disc before the middle, followed by a small white spot edged with black. The costa is sprinkled with fuscous scales. The hindwings are gray fuscous.Beutenmüller, William (1889) "On North American Tineidae" Entomologica Americana. 5: 1 p. 10 Adults are on wing from March to December.Bug Guide

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding44 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonopterix curvilineella has left across the world's sequence archives.

At a glance

DNA specimens44

BINs1

Marker genes1

eDNA detections43

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus42 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

25Tmostly conserved

118Tmostly conserved

163Tmostly conserved

212Cmostly conserved

214Amostly conserved

247Tmostly conserved

265Amostly conserved

268Gmostly conserved

355Cmostly conserved

451Tmostly conserved

508Tmostly conserved

517Gmostly conserved

542Cmostly conserved

574Tmostly conserved

625Amostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGTACATCTTTAAGATTATTAATTCGTGCTGAATTAGGTAATCCTGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.85%

Haplotypes8

BIN1

Most divergent pair2.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonopterix cnicellasame genus5.3%Agonopterix oregonensissame genus5.4%Agonopterix astrantiaesame genus5.5%Agonopterix latipennellasame genus5.5%Agonopterix atomellasame genus5.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type473 records

Wild obs. + sensor383

Museum / vouchered90

Range

Area of Occupancy AOO976 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 241≤1 km 48≤10 km 9>10 km 31

329 georeferenced · 54 without coordinates

Open the mapobservation + sensor383

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤1 km 9≤10 km 3>10 km 2

14 georeferenced · 76 without coordinates

Open the institutions mapphysical evidence90

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
North Carolina State University Insect Museumlocation not on record	17
University of Guelph, Centre for Biodiversity Genomicslocation not on record	10
Mississippi State, US	9
Washington, US	8
St. Paul, US	7
Philadelphia, US	4
Cornell University Insect Collectionlocation not on record	3
Cleveland Museum of Natural History, OH (CLEV)location not on record	2
Smithsonian Institution, National Museum of Natural Historylocation not on record	2
Universidad Católica de Manizaleslocation not on record	1
East Lansing, US	1

11 institutions · 64 of 90 vouchered records shown · 26 without an institution code

09Environmental DNA43 detections

Where the DNA of Agonopterix curvilineella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found43

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 43 detections have coordinates

Open the map2 countries0

ForestTemperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 6.80–20.4

Seasonal swing summer↔winter30.4 °C

Max temp (day)21.0 °C 12.2–25.1

Min temp (night)12.4 °C 1.60–16.3

Precipitation113 mm/mo 78.8–126

Air humidity59.9 % 55.3–61.4

Moisture balance-13.7 mm/mo -39.0–1.40

Vapour deficit754 Pa 448–965

Wind speed2.40 m/s 2.20–4.50

Cloud cover45.9 % 42.7–52.9

CHELSA 1981–2010, ~9 km grid, at location & month of 43 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)