Agonopterix cnicella

Treitschke, 1832 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Agonopterix

At a glance

Occurrence records229

Data sources6

Biological traits2

DNA specimens21

eDNA detections0

Sources6 archives

Databases and archives Agonopterix cnicella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility229 records↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF229 records

DNA & barcodingBOLD21 specimens

01Narrative

Agonopterix cnicella is a moth of the family Depressariidae. It is found in most of Europe, except Ireland, Fennoscandia, Portugal, the central part of the Balkan Peninsula, Latvia and Estonia. It has also been recorded from Morocco and Asia Minor.Agonopterix at funet A shoot of Eryngium campestre attacked by larva Larva The wingspan is 18–22 mm.microlepidoptera.nl Adults are on wing from June to July. The larvae feed on Eryngium species, including Eryngium maritimum and Eryngium campestre. They feed amongst spun leaves and shoots, often causing brown discolouration. Several larvae may be found together on the host plant.UKmoths Larvae can be found from May to the beginning of June.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonopterix cnicella has left across the world's sequence archives.

At a glance

DNA specimens21

BINs1

Marker genes1

Countries13

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

1Amostly conserved

22Amostly conserved

49Tmostly conserved

82Tmostly conserved

106Cvariable

121Cmostly conserved

133Tmostly conserved

169Tmostly conserved

271Tmostly conserved

278Cmostly conserved

316Amostly conserved

358Tmostly conserved

400Amostly conserved

412Tmostly conserved

451Tmostly conserved

491Cmostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCTTTAAGATTATTAATTCGTGCTGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.76%

Haplotypes10

BIN1

Most divergent pair2.3%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonopterix melancholicasame genus1.5%Agonopterix carduncellisame genus3.0%Agonopterix multiplicellasame genus3.0%Agonopterix straminellasame genus3.3%Agonopterix adspersellasame genus3.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type229 records

Wild obs. + sensor186

Museum / vouchered41

Other2

Range

Area of Occupancy AOO564 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy34% within 1 km

≤100 m 34≤1 km 25≤10 km 112>10 km 1

172 georeferenced · 14 without coordinates

Open the mapobservation + sensor186

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 3≤1 km 6≤10 km 10

19 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence41

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	7
Provincia di Livornolocation not on record	6
Nijmegen, NL	4
ZAF-UMUlocation not on record	4
Tilburg, NL	4
Tartu, EE	3
NHMOlocation not on record	2
Natural History Museum, Londonlocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1

9 institutions · 32 of 41 vouchered records shown · 9 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)