Agonopterix capreolella

Zeller, 1839 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Agonopterix

At a glance

Occurrence records534

Data sources7

Biological traits2

DNA specimens27

eDNA detections19

Sources7 archives

Databases and archives Agonopterix capreolella's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility534 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics27 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF534 records

Environmental DNA1 datasets · 7 countries19 detections

DNA & barcodingBOLD27 specimens

01Narrative

Agonopterix capreolella is a moth of the family Depressariidae. It is found in most of Europe, the eastern Palearctic realm, and the Near East. The wingspan is 15–19 mm.The forewings are light fuscous; base pale ; first discal stigma black, preceded by a similar dot obliquely above it, second white, obscurely dark-edged, preceded by a similar dot ; dark fuscous terminal dots. Hindwings are whitish-fuscous, darker terminally. The larva is green ; dorsal and subdorsal lines darker; head and plate of 2 black.Meyrick, E., 1895 A Handbook of British Lepidoptera MacMillan, London pdf Keys and description Adults are on wing from August to May. The larvae feed on Pimpinella saxifraga, Daucus carota, and Sium latifolium.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding27 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonopterix capreolella has left across the world's sequence archives.

At a glance

DNA specimens27

BINs2

Marker genes1

eDNA detections19

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus24 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

212Cmostly conserved

220Tvariable

238Cmostly conserved

268Amostly conserved

340Cmostly conserved

376Tmostly conserved

388Amostly conserved

418Cmostly conserved

477Amostly conserved

493Amostly conserved

514Cvariable

533Tvariable

604Amostly conserved

616Cmostly conserved

622Cvariable

628Gvariable

640Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCCTTAAGATTATTAATTCGTGCCGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes9

BINs2

Most divergent pair2.6%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonopterix angelicellasame genus4.1%Agonopterix carduncellisame genus4.3%Agonopterix paraselinisame genus4.4%Agonopterix latipennellasame genus4.4%Agonopterix flavicomellasame genus4.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type534 records

Wild obs. + sensor189

Museum / vouchered303

Other42

Range

Area of Occupancy AOO1 160 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 44≤1 km 49≤10 km 67>10 km 3

163 georeferenced · 26 without coordinates

Open the mapobservation + sensor189

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 25≤1 km 89≤10 km 150>10 km 3

267 georeferenced · 36 without coordinates

Open the institutions mapphysical evidence303

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	157
Tartu, EE	43
Provincia di Livornolocation not on record	26
NHMOlocation not on record	17
DanishLepidopterologicalSocietylocation not on record	8
SLU Artdatabankenlocation not on record	6
Salzburg, AT	3
Rovaniemi, FI	3
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	3
Tallinn, EE	2
European Distributed Institute of Taxonomy (EDIT)location not on record	2
Natural History Museum Rotterdamlocation not on record	2
South Kensington, GB	2
Tiroler Landesmuseum Ferdinandeumlocation not on record	1
ZSMlocation not on record	1
Stockholm, SE	1
Philadelphia, US	1
Kuopio, FI	1
Research Collection of Kai Berggrenlocation not on record	1

19 institutions · 280 of 303 vouchered records shown · 23 without an institution code

09Environmental DNA19 detections

Where the DNA of Agonopterix capreolella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map7 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.80 °C 3.60–16.1

Seasonal swing summer↔winter20.3 °C

Max temp (day)14.1 °C 7.30–19.6

Min temp (night)3.60 °C -2.10–11.8

Precipitation86.9 mm/mo 35.1–179

Air humidity59.9 % 55.6–64.0

Moisture balance12.0 mm/mo -62.8–79.5

Vapour deficit460 Pa 323–789

Wind speed3.10 m/s 2.00–4.20

Cloud cover40.7 % 35.5–51.0

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)